Mutagenetix > Incidental Mutation

Incidental Mutation 'R0927:Gm5346'

80511

Institutional Source

Beutler Lab

Gene Symbol

Gm5346

Ensembl Gene

ENSMUSG00000050190

Gene Name

predicted gene 5346

Synonyms

MMRRC Submission

039074-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.059) question?

Stock #

R0927 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

43624951-43627276 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 43625123 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 688 (M688K)

Ref Sequence

ENSEMBL: ENSMUSP00000058858 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000056023]

AlphaFold

Q7M766

Predicted Effect

probably benign
Transcript: ENSMUST00000056023
AA Change: M688K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000058858
Gene: ENSMUSG00000050190
AA Change: M688K

Domain	Start	End	E-Value	Type
transmembrane domain	13	32	N/A	INTRINSIC
Pfam:Pep_M12B_propep	39	159	1.3e-18	PFAM
Pfam:Reprolysin_5	205	384	1.1e-15	PFAM
Pfam:Reprolysin_4	205	393	6.2e-9	PFAM
Pfam:Reprolysin	207	397	1.7e-46	PFAM
Pfam:Reprolysin_2	223	389	5.7e-14	PFAM
Pfam:Reprolysin_3	231	352	2.6e-13	PFAM
DISIN	416	491	2.48e-38	SMART
ACR	492	628	3.4e-65	SMART
EGF	634	664	2.69e1	SMART
transmembrane domain	685	707	N/A	INTRINSIC

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.0%
20x: 93.7%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb8	T	C	5: 24,402,319	L363P	probably damaging	Het
Adam12	T	A	7: 133,998,230	H85L	probably damaging	Het
Adam34	A	T	8: 43,651,584	H341Q	probably damaging	Het
Adam7	A	G	14: 68,516,684	L322P	probably damaging	Het
Adcy5	T	A	16: 35,156,243	S49T	probably benign	Het
Arfgap2	T	C	2: 91,273,805	S374P	probably benign	Het
Arpp19	G	A	9: 75,037,685		probably benign	Het
Baz1a	T	C	12: 54,894,988	K1478E	probably damaging	Het
Cdc27	G	T	11: 104,505,641	A812E	possibly damaging	Het
Chtf8	G	A	8: 106,885,518	T263I	probably damaging	Het
Clcn6	T	C	4: 148,029,392	N70D	probably benign	Het
Cntnap5c	A	T	17: 58,042,558	T289S	possibly damaging	Het
Dzip3	T	C	16: 48,975,477	N177S	probably damaging	Het
Edar	G	T	10: 58,629,491		probably null	Het
Enam	T	A	5: 88,494,060	N244K	possibly damaging	Het
Fbxw10	A	G	11: 62,876,944	K874E	probably damaging	Het
Glra3	A	G	8: 56,125,204	E432G	possibly damaging	Het
Gm13084	A	T	4: 143,812,808	D38E	probably benign	Het
Gm13088	T	A	4: 143,654,220	H411L	possibly damaging	Het
Grin3b	G	A	10: 79,971,228	R110Q	probably benign	Het
Herc3	T	A	6: 58,868,763	V423D	possibly damaging	Het
Ifit2	A	T	19: 34,573,584	T175S	probably benign	Het
Kcnj8	T	G	6: 142,565,901	I327L	possibly damaging	Het
Kcns2	A	T	15: 34,839,096	I202F	probably benign	Het
Kif12	T	C	4: 63,168,773	R305G	possibly damaging	Het
Limch1	A	G	5: 66,997,233	D362G	probably damaging	Het
Lrba	T	C	3: 86,780,233	I2815T	probably damaging	Het
Lrrtm1	G	T	6: 77,244,860	M433I	probably damaging	Het
Myh7b	A	G	2: 155,620,120	D312G	probably damaging	Het
Nrxn1	A	T	17: 90,037,330	I382N	probably damaging	Het
Nudt6	C	T	3: 37,405,353	R161H	probably benign	Het
Olfr1490	T	A	19: 13,654,452	W8R	probably damaging	Het
Olfr734	A	T	14: 50,320,729	Y35*	probably null	Het
Olfr744	A	C	14: 50,618,587	M122L	possibly damaging	Het
Olfr857	C	T	9: 19,713,649	A274V	probably benign	Het
Pmf1	A	T	3: 88,396,062	V64D	probably damaging	Het
Pomgnt1	T	A	4: 116,151,851	V29D	probably damaging	Het
Prex1	C	T	2: 166,586,537	A925T	probably benign	Het
Pus3	A	G	9: 35,565,031	Y72C	probably damaging	Het
Rnf20	T	C	4: 49,642,176	S247P	probably damaging	Het
Rnf213	T	A	11: 119,414,570	D542E	probably benign	Het
Sidt1	T	C	16: 44,243,532	D786G	probably benign	Het
Sirt6	A	T	10: 81,622,641	D219E	probably damaging	Het
Slc36a2	A	T	11: 55,181,585	I67N	probably damaging	Het
Slc47a1	A	G	11: 61,373,422	F57S	probably damaging	Het
Spg11	T	A	2: 122,094,487	T756S	probably damaging	Het
Sptbn1	C	A	11: 30,121,591	R1447L	probably damaging	Het
Tcf7l2	A	G	19: 55,918,955	M340V	probably damaging	Het
Thap1	T	C	8: 26,162,705	V157A	probably benign	Het
Ubash3b	G	A	9: 41,023,557	Q354*	probably null	Het
Ubtd1	G	A	19: 42,032,021	W68*	probably null	Het
Wdr64	G	T	1: 175,793,081	R793L	probably damaging	Het
Zbtb24	C	T	10: 41,451,436	T106I	probably benign	Het
Zbtb26	T	C	2: 37,436,325	N233S	possibly damaging	Het
Zcchc24	A	T	14: 25,757,161	N99K	possibly damaging	Het

Other mutations in Gm5346

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00321:Gm5346	APN	8	43625381	missense	probably benign	0.12
IGL00391:Gm5346	APN	8	43625629	missense	probably damaging	1.00
IGL00422:Gm5346	APN	8	43626351	missense	probably damaging	1.00
IGL00664:Gm5346	APN	8	43625969	missense	probably benign
IGL01095:Gm5346	APN	8	43626096	missense	probably benign	0.22
IGL01113:Gm5346	APN	8	43626152	missense	probably damaging	1.00
IGL01444:Gm5346	APN	8	43626433	missense	probably benign	0.06
IGL01782:Gm5346	APN	8	43626735	missense	probably benign	0.01
IGL01921:Gm5346	APN	8	43625511	missense	probably damaging	0.96
IGL01964:Gm5346	APN	8	43626761	missense	probably benign	0.00
IGL02139:Gm5346	APN	8	43625578	missense	probably benign	0.01
IGL02555:Gm5346	APN	8	43625268	missense	probably damaging	1.00
IGL02951:Gm5346	APN	8	43627088	missense	possibly damaging	0.62
R0056:Gm5346	UTSW	8	43625503	nonsense	probably null
R0218:Gm5346	UTSW	8	43626440	missense	probably benign	0.00
R0530:Gm5346	UTSW	8	43626531	missense	probably benign	0.00
R0925:Gm5346	UTSW	8	43626303	missense	probably benign	0.11
R0975:Gm5346	UTSW	8	43625118	missense	probably benign
R1300:Gm5346	UTSW	8	43626844	nonsense	probably null
R1728:Gm5346	UTSW	8	43625583	missense	probably damaging	1.00
R1729:Gm5346	UTSW	8	43625583	missense	probably damaging	1.00
R1801:Gm5346	UTSW	8	43625917	nonsense	probably null
R1869:Gm5346	UTSW	8	43625095	nonsense	probably null
R1870:Gm5346	UTSW	8	43625095	nonsense	probably null
R1871:Gm5346	UTSW	8	43625095	nonsense	probably null
R1992:Gm5346	UTSW	8	43627139	missense	probably benign	0.44
R2008:Gm5346	UTSW	8	43627037	missense	probably benign	0.00
R2013:Gm5346	UTSW	8	43626405	missense	possibly damaging	0.81
R2022:Gm5346	UTSW	8	43625917	nonsense	probably null
R2175:Gm5346	UTSW	8	43625438	missense	probably benign
R2875:Gm5346	UTSW	8	43627140	nonsense	probably null
R3406:Gm5346	UTSW	8	43626052	nonsense	probably null
R3845:Gm5346	UTSW	8	43626632	missense	probably benign	0.00
R4033:Gm5346	UTSW	8	43626673	missense	probably benign	0.28
R4072:Gm5346	UTSW	8	43626350	missense	probably damaging	1.00
R4074:Gm5346	UTSW	8	43626350	missense	probably damaging	1.00
R4075:Gm5346	UTSW	8	43626350	missense	probably damaging	1.00
R4076:Gm5346	UTSW	8	43626350	missense	probably damaging	1.00
R4153:Gm5346	UTSW	8	43626527	missense	probably benign	0.04
R4330:Gm5346	UTSW	8	43626250	missense	probably benign
R4612:Gm5346	UTSW	8	43626550	missense	probably benign	0.09
R4662:Gm5346	UTSW	8	43627079	missense	probably benign	0.26
R5032:Gm5346	UTSW	8	43626471	missense	probably damaging	1.00
R5077:Gm5346	UTSW	8	43627163	missense	possibly damaging	0.79
R5504:Gm5346	UTSW	8	43625282	missense	probably damaging	1.00
R5697:Gm5346	UTSW	8	43626579	missense	probably damaging	1.00
R6232:Gm5346	UTSW	8	43625912	missense	probably benign	0.00
R6233:Gm5346	UTSW	8	43625912	missense	probably benign	0.00
R6234:Gm5346	UTSW	8	43625912	missense	probably benign	0.00
R6235:Gm5346	UTSW	8	43625912	missense	probably benign	0.00
R6241:Gm5346	UTSW	8	43626096	missense	probably benign	0.22
R6392:Gm5346	UTSW	8	43626001	missense	probably benign	0.09
R6439:Gm5346	UTSW	8	43625951	missense	probably damaging	1.00
R6454:Gm5346	UTSW	8	43626808	missense	probably damaging	0.96
R6455:Gm5346	UTSW	8	43626152	missense	probably damaging	1.00
R6767:Gm5346	UTSW	8	43626914	missense	probably damaging	1.00
R6774:Gm5346	UTSW	8	43625183	missense	probably benign	0.00
R6877:Gm5346	UTSW	8	43625237	missense	probably benign	0.02
R6911:Gm5346	UTSW	8	43625109	missense	probably benign	0.02
R7211:Gm5346	UTSW	8	43625877	missense	probably damaging	1.00
R7597:Gm5346	UTSW	8	43625244	missense	probably damaging	1.00
R7602:Gm5346	UTSW	8	43626666	missense	probably damaging	0.99
R7797:Gm5346	UTSW	8	43626374	missense	probably benign	0.04
R7981:Gm5346	UTSW	8	43625813	missense	probably damaging	1.00
R8154:Gm5346	UTSW	8	43625387	missense	probably damaging	0.97
R8215:Gm5346	UTSW	8	43626501	missense	probably benign	0.05
R9180:Gm5346	UTSW	8	43626933	nonsense	probably null
R9307:Gm5346	UTSW	8	43626267	missense	probably benign	0.00
R9733:Gm5346	UTSW	8	43626149	missense	possibly damaging	0.94
RF001:Gm5346	UTSW	8	43626905	missense	possibly damaging	0.79
Z1177:Gm5346	UTSW	8	43626546	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GAGGATGCAGAACATCTGACCTGG -3'
(R):5'- CCATAGATGACGTTGGAGCAGTGAG -3'

Sequencing Primer
(F):5'- cacacacacacacacacac -3'
(R):5'- TCTCGACAGAAAGTGTGTCAGC -3'

Posted On

2013-11-07