Incidental Mutation 'R2893:Trappc10'
ID 260674
Institutional Source Beutler Lab
Gene Symbol Trappc10
Ensembl Gene ENSMUSG00000000374
Gene Name trafficking protein particle complex 10
Synonyms B230307C21Rik, Tmem1, b2b2613Clo, b2b2416Clo, LOC380642
MMRRC Submission 040481-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2893 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 78022559-78080475 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 78029235 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 1101 (V1101M)
Ref Sequence ENSEMBL: ENSMUSP00000000384 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000384]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000000384
AA Change: V1101M

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000000384
Gene: ENSMUSG00000000374
AA Change: V1101M

DomainStartEndE-ValueType
Pfam:TRAPPC10 1016 1245 1.1e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219948
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transmembrane protein found in the cis-Golgi complex. The encoded protein is part of the multisubunit transport protein particle (TRAPP) complex and may be involved in vesicular transport from the endoplasmic reticulum to the Golgi. Mutations in this gene could be responsible for the Unverricht-Lundborg type of progressive myoclonus epilepsy, or for autoimmune polyglandular disease type 1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for ENU-induced mutations exhibit cardiovascular phenotypes, including atrioventricular or ventricular septal defects, thymus hypoplasia, and eye defects such as microphthalmia or anophthalmia. Holoprosencephaly, anencephaly and severe craniofacial defects may be also present. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 C T 6: 128,557,349 (GRCm39) A115T probably benign Het
Abl1 T G 2: 31,687,624 (GRCm39) S521R probably benign Het
Acox3 A G 5: 35,757,192 (GRCm39) I344V probably benign Het
Ank2 T C 3: 127,041,892 (GRCm39) probably null Het
Atoh8 A T 6: 72,211,856 (GRCm39) F98Y probably benign Het
Caskin2 C T 11: 115,692,103 (GRCm39) G894E probably benign Het
Cdh15 G A 8: 123,583,374 (GRCm39) R59H probably benign Het
Cdk5rap2 T C 4: 70,208,110 (GRCm39) K779E probably benign Het
Csmd2 T A 4: 128,432,786 (GRCm39) probably null Het
Cubn T C 2: 13,362,950 (GRCm39) D1687G possibly damaging Het
F11 A G 8: 45,701,675 (GRCm39) S353P probably damaging Het
Faap100 T C 11: 120,265,451 (GRCm39) D475G probably damaging Het
Fhip2a C T 19: 57,372,601 (GRCm39) P617L probably benign Het
Gm13090 T A 4: 151,175,157 (GRCm39) L78* probably null Het
Ikbke G A 1: 131,197,961 (GRCm39) P382S probably damaging Het
Il4i1 A G 7: 44,487,414 (GRCm39) I130V probably damaging Het
Islr2 A T 9: 58,105,149 (GRCm39) S704T probably damaging Het
Itga10 A G 3: 96,562,416 (GRCm39) N733D probably benign Het
Itih2 C T 2: 10,107,008 (GRCm39) G662D possibly damaging Het
Kansl1l T C 1: 66,840,493 (GRCm39) Q269R probably damaging Het
Kcnj3 A T 2: 55,337,027 (GRCm39) I298F probably damaging Het
Kdr A G 5: 76,107,496 (GRCm39) F1016L probably damaging Het
Miga2 A T 2: 30,268,306 (GRCm39) probably null Het
Or51ai2 A T 7: 103,587,389 (GRCm39) R267S probably damaging Het
Per2 C A 1: 91,373,325 (GRCm39) Q154H probably damaging Het
Pik3ap1 G A 19: 41,364,500 (GRCm39) A73V probably benign Het
Plod3 G C 5: 137,017,000 (GRCm39) A50P probably benign Het
Psma5-ps T C 10: 85,149,848 (GRCm39) noncoding transcript Het
Rad18 G A 6: 112,652,734 (GRCm39) Q288* probably null Het
Rapsn A T 2: 90,867,169 (GRCm39) D157V probably damaging Het
Slc2a8 A T 2: 32,864,966 (GRCm39) W394R probably damaging Het
Srcap T C 7: 127,138,237 (GRCm39) S1136P probably damaging Het
Tenm4 T A 7: 96,544,197 (GRCm39) V2108D probably damaging Het
Ttbk2 C A 2: 120,576,091 (GRCm39) probably null Het
Usp8 A T 2: 126,600,075 (GRCm39) Q998L probably damaging Het
Vmn2r114 ATTT ATT 17: 23,509,906 (GRCm39) probably null Het
Vmn2r80 T C 10: 78,984,699 (GRCm39) F17S possibly damaging Het
Other mutations in Trappc10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00329:Trappc10 APN 10 78,039,711 (GRCm39) splice site probably benign
IGL01375:Trappc10 APN 10 78,024,733 (GRCm39) missense possibly damaging 0.75
IGL01413:Trappc10 APN 10 78,033,678 (GRCm39) missense possibly damaging 0.87
IGL02413:Trappc10 APN 10 78,046,610 (GRCm39) missense probably damaging 0.99
IGL03037:Trappc10 APN 10 78,034,869 (GRCm39) unclassified probably benign
IGL03094:Trappc10 APN 10 78,064,754 (GRCm39) splice site probably benign
IGL03164:Trappc10 APN 10 78,056,076 (GRCm39) missense probably damaging 1.00
IGL03351:Trappc10 APN 10 78,024,595 (GRCm39) missense probably damaging 1.00
IGL03055:Trappc10 UTSW 10 78,050,520 (GRCm39) missense probably damaging 1.00
IGL03098:Trappc10 UTSW 10 78,050,520 (GRCm39) missense probably damaging 1.00
R0304:Trappc10 UTSW 10 78,046,594 (GRCm39) splice site probably benign
R0605:Trappc10 UTSW 10 78,037,331 (GRCm39) missense possibly damaging 0.70
R1806:Trappc10 UTSW 10 78,046,610 (GRCm39) missense probably damaging 0.99
R1856:Trappc10 UTSW 10 78,032,285 (GRCm39) missense probably benign 0.00
R2045:Trappc10 UTSW 10 78,045,313 (GRCm39) splice site probably benign
R2088:Trappc10 UTSW 10 78,032,168 (GRCm39) missense probably benign 0.00
R2126:Trappc10 UTSW 10 78,039,758 (GRCm39) missense possibly damaging 0.94
R2202:Trappc10 UTSW 10 78,034,876 (GRCm39) critical splice donor site probably null
R2509:Trappc10 UTSW 10 78,047,357 (GRCm39) missense possibly damaging 0.51
R2510:Trappc10 UTSW 10 78,047,357 (GRCm39) missense possibly damaging 0.51
R2511:Trappc10 UTSW 10 78,047,357 (GRCm39) missense possibly damaging 0.51
R3744:Trappc10 UTSW 10 78,034,924 (GRCm39) missense probably benign 0.00
R3778:Trappc10 UTSW 10 78,036,636 (GRCm39) missense possibly damaging 0.89
R3876:Trappc10 UTSW 10 78,056,020 (GRCm39) splice site probably null
R3930:Trappc10 UTSW 10 78,046,237 (GRCm39) missense probably benign 0.03
R4078:Trappc10 UTSW 10 78,046,216 (GRCm39) missense probably damaging 1.00
R4111:Trappc10 UTSW 10 78,032,264 (GRCm39) missense probably benign 0.09
R4418:Trappc10 UTSW 10 78,053,022 (GRCm39) missense probably damaging 1.00
R4549:Trappc10 UTSW 10 78,067,292 (GRCm39) missense probably damaging 1.00
R4695:Trappc10 UTSW 10 78,033,697 (GRCm39) missense probably damaging 0.99
R4799:Trappc10 UTSW 10 78,037,424 (GRCm39) missense possibly damaging 0.71
R5022:Trappc10 UTSW 10 78,052,994 (GRCm39) missense possibly damaging 0.72
R5023:Trappc10 UTSW 10 78,052,994 (GRCm39) missense possibly damaging 0.72
R5026:Trappc10 UTSW 10 78,040,122 (GRCm39) missense possibly damaging 0.82
R5057:Trappc10 UTSW 10 78,052,994 (GRCm39) missense possibly damaging 0.72
R5282:Trappc10 UTSW 10 78,023,694 (GRCm39) missense probably damaging 1.00
R5363:Trappc10 UTSW 10 78,024,674 (GRCm39) missense possibly damaging 0.92
R5813:Trappc10 UTSW 10 78,058,573 (GRCm39) missense probably damaging 1.00
R5831:Trappc10 UTSW 10 78,045,260 (GRCm39) missense probably damaging 1.00
R6209:Trappc10 UTSW 10 78,050,646 (GRCm39) missense possibly damaging 0.50
R6450:Trappc10 UTSW 10 78,045,284 (GRCm39) missense possibly damaging 0.92
R6520:Trappc10 UTSW 10 78,037,287 (GRCm39) missense probably benign 0.00
R6533:Trappc10 UTSW 10 78,024,728 (GRCm39) missense probably damaging 0.96
R6767:Trappc10 UTSW 10 78,029,345 (GRCm39) missense possibly damaging 0.75
R6798:Trappc10 UTSW 10 78,024,665 (GRCm39) missense probably benign 0.00
R7205:Trappc10 UTSW 10 78,046,262 (GRCm39) missense probably damaging 1.00
R7282:Trappc10 UTSW 10 78,043,327 (GRCm39) missense probably damaging 0.98
R7378:Trappc10 UTSW 10 78,029,252 (GRCm39) missense probably damaging 0.96
R7384:Trappc10 UTSW 10 78,045,218 (GRCm39) missense possibly damaging 0.85
R7770:Trappc10 UTSW 10 78,046,679 (GRCm39) missense probably damaging 0.96
R7829:Trappc10 UTSW 10 78,034,909 (GRCm39) missense probably benign
R7839:Trappc10 UTSW 10 78,024,646 (GRCm39) missense possibly damaging 0.84
R8298:Trappc10 UTSW 10 78,038,753 (GRCm39) missense probably damaging 1.00
R8306:Trappc10 UTSW 10 78,036,460 (GRCm39) missense possibly damaging 0.54
R8814:Trappc10 UTSW 10 78,038,753 (GRCm39) missense probably damaging 1.00
R9035:Trappc10 UTSW 10 78,043,723 (GRCm39) unclassified probably benign
R9075:Trappc10 UTSW 10 78,040,130 (GRCm39) missense possibly damaging 0.77
R9112:Trappc10 UTSW 10 78,029,201 (GRCm39) missense probably damaging 0.99
R9182:Trappc10 UTSW 10 78,050,464 (GRCm39) missense probably damaging 1.00
R9444:Trappc10 UTSW 10 78,033,612 (GRCm39) missense probably benign 0.10
R9801:Trappc10 UTSW 10 78,045,263 (GRCm39) missense probably benign 0.00
Z1177:Trappc10 UTSW 10 78,052,987 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGATAACAGAGCTGTGCTTAGTGAG -3'
(R):5'- ACTAGCTGCCAAGGTGGTTC -3'

Sequencing Primer
(F):5'- AGCCAGGACTGTGCTTGATC -3'
(R):5'- TCTGGCCACTTGGGTAAAC -3'
Posted On 2015-01-23