Mutagenetix > Incidental Mutation

Incidental Mutation 'R3103:Plb1'

262893

Institutional Source

Beutler Lab

Gene Symbol

Plb1

Ensembl Gene

ENSMUSG00000029134

Gene Name

phospholipase B1

Synonyms

4930539A06Rik, 4632413E21Rik, 4930433E17Rik

MMRRC Submission

040577-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.054) question?

Stock #

R3103 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

32232708-32366520 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 32328029 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 842 (M842K)

Ref Sequence

ENSEMBL: ENSMUSP00000144040 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000101376] [ENSMUST00000202220]

AlphaFold

Q3TTY0

Predicted Effect

possibly damaging
Transcript: ENSMUST00000101376
AA Change: M842K

PolyPhen 2 Score 0.924 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000098927
Gene: ENSMUSG00000029134
AA Change: M842K

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
low complexity region	57	69	N/A	INTRINSIC
Pfam:Lipase_GDSL	398	672	4e-20	PFAM
Pfam:Lipase_GDSL	745	1019	1.7e-17	PFAM
Pfam:Lipase_GDSL	1101	1367	4.6e-15	PFAM
transmembrane domain	1420	1442	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000202220
AA Change: M842K

PolyPhen 2 Score 0.924 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000144040
Gene: ENSMUSG00000029134
AA Change: M842K

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
low complexity region	57	69	N/A	INTRINSIC
Pfam:Lipase_GDSL	398	672	4e-20	PFAM
Pfam:Lipase_GDSL	745	1019	1.7e-17	PFAM
Pfam:Lipase_GDSL	1101	1367	4.6e-15	PFAM
transmembrane domain	1420	1442	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202688

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202886

Coding Region Coverage

1x: 99.1%
3x: 98.6%
10x: 97.4%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane-associated phospholipase that displays lysophospholipase and phospholipase A2 activities through removal of sn-1 and sn-2 fatty acids of glycerophospholipids. In addition, it displays lipase and retinyl ester hydrolase activities. The encoded protein is highly conserved and is composed of a large, glycosylated extracellular domain composed of four tandem homologous domains, followed by a hydrophobic segment that anchors the enzyme to the membrane and a short C-terminal cytoplasmic tail. This gene has been identified as a candidate rheumatoid arthritis risk gene. [provided by RefSeq, Jul 2016]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acp7	A	G	7: 28,610,984		probably null	Het
Adap2	G	T	11: 80,157,033	C105F	probably damaging	Het
Bace2	T	C	16: 97,422,001		probably null	Het
Bpifc	A	G	10: 85,993,422	S94P	probably damaging	Het
C2cd3	A	G	7: 100,395,252	D347G	possibly damaging	Het
Cad	T	C	5: 31,061,674	V613A	possibly damaging	Het
Ccdc47	T	C	11: 106,202,841	H6R	probably benign	Het
Celsr3	A	G	9: 108,837,139	T1956A	probably benign	Het
Cep128	T	A	12: 91,019,344	D1006V	probably damaging	Het
Cog3	T	C	14: 75,747,201		probably null	Het
Csmd1	C	T	8: 15,917,405	V3153M	probably damaging	Het
Ctnna2	T	C	6: 77,653,144	E122G	possibly damaging	Het
Cts8	T	A	13: 61,250,958	I245F	probably damaging	Het
Ddx27	T	A	2: 167,026,246	V333E	probably damaging	Het
Dmpk	A	G	7: 19,087,654	Y279C	probably damaging	Het
Dpagt1	A	G	9: 44,327,995	I111V	probably benign	Het
Dvl2	C	A	11: 70,008,869	P546T	possibly damaging	Het
Fat4	G	T	3: 38,891,940	A1661S	probably benign	Het
Gcm1	A	G	9: 78,064,452	N225S	probably damaging	Het
Gcnt2	A	T	13: 40,918,606	M242L	probably benign	Het
Golgb1	A	G	16: 36,894,849	R226G	probably damaging	Het
Gpr63	G	A	4: 25,007,353	V26I	probably benign	Het
Grik2	A	G	10: 49,240,772	L631P	probably damaging	Het
Hapln3	T	C	7: 79,121,736	D135G	probably benign	Het
Il31ra	C	A	13: 112,530,351	V398F	probably damaging	Het
Ipp	G	T	4: 116,524,249	R315L	possibly damaging	Het
Kcmf1	A	G	6: 72,861,847	L32P	probably damaging	Het
Klf17	T	A	4: 117,760,608	Q184L	possibly damaging	Het
Lrp2	C	T	2: 69,431,984	V4442I	probably benign	Het
Lrrfip2	A	T	9: 111,222,210	E293D	probably damaging	Het
Oit3	A	G	10: 59,438,891	I29T	probably damaging	Het
Olfr403	G	A	11: 74,196,075	D191N	probably benign	Het
Olfr50	T	C	2: 36,793,562	C109R	possibly damaging	Het
Olfr555	T	C	7: 102,659,481	V220A	probably benign	Het
Ppt1	T	C	4: 122,836,307	C18R	probably benign	Het
Pstpip2	T	C	18: 77,871,777	Y191H	probably damaging	Het
Ryr1	C	T	7: 29,074,948	V2361I	probably damaging	Het
Serpinb11	A	G	1: 107,377,608	N238S	probably benign	Het
Skor2	A	T	18: 76,859,278	K232*	probably null	Het
Slc13a5	A	T	11: 72,257,388	W231R	probably damaging	Het
Svs5	A	T	2: 164,333,393	E55V	probably benign	Het
Tfcp2	A	T	15: 100,525,600	W142R	probably damaging	Het
Trpc2	A	T	7: 102,095,234	I738F	possibly damaging	Het
Vmn2r61	T	A	7: 42,266,643	S227T	possibly damaging	Het
Zfhx4	A	G	3: 5,399,326	T1540A	probably damaging	Het
Zfp616	A	G	11: 74,071,735	T74A	probably benign	Het

Other mutations in Plb1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00096:Plb1	APN	5	32345736	missense	probably benign	0.00
IGL00542:Plb1	APN	5	32269834	missense	probably benign	0.02
IGL00835:Plb1	APN	5	32364172	missense	unknown
IGL00954:Plb1	APN	5	32298514	splice site	probably benign
IGL01350:Plb1	APN	5	32317064	missense	probably damaging	1.00
IGL01527:Plb1	APN	5	32317123	missense	probably damaging	1.00
IGL01599:Plb1	APN	5	32342544	splice site	probably benign
IGL01690:Plb1	APN	5	32313697	missense	probably damaging	1.00
IGL01813:Plb1	APN	5	32329085	missense	probably damaging	1.00
IGL01826:Plb1	APN	5	32281145	missense	probably damaging	0.99
IGL02263:Plb1	APN	5	32321348	splice site	probably benign
IGL02314:Plb1	APN	5	32281148	missense	possibly damaging	0.93
IGL02649:Plb1	APN	5	32362568	missense	probably benign	0.09
IGL02701:Plb1	APN	5	32364197	missense	unknown
IGL02704:Plb1	APN	5	32353667	missense	probably benign	0.03
IGL03170:Plb1	APN	5	32284902	missense	probably damaging	0.99
IGL03182:Plb1	APN	5	32344915	splice site	probably benign
IGL03326:Plb1	APN	5	32331327	missense	probably benign	0.00
IGL03046:Plb1	UTSW	5	32328412	missense	probably damaging	1.00
R0013:Plb1	UTSW	5	32349615	splice site	probably benign
R0013:Plb1	UTSW	5	32349615	splice site	probably benign
R0034:Plb1	UTSW	5	32273113	missense	probably benign	0.16
R0034:Plb1	UTSW	5	32273113	missense	probably benign	0.16
R0330:Plb1	UTSW	5	32355357	missense	probably damaging	1.00
R0413:Plb1	UTSW	5	32355362	missense	probably damaging	1.00
R0721:Plb1	UTSW	5	32364195	missense	unknown
R0735:Plb1	UTSW	5	32284920	missense	possibly damaging	0.90
R1423:Plb1	UTSW	5	32293257	missense	probably benign
R1428:Plb1	UTSW	5	32264912	missense	possibly damaging	0.82
R1469:Plb1	UTSW	5	32354826	missense	possibly damaging	0.46
R1469:Plb1	UTSW	5	32354826	missense	possibly damaging	0.46
R1694:Plb1	UTSW	5	32317277	missense	probably null	0.01
R1801:Plb1	UTSW	5	32293243	missense	probably damaging	1.00
R1804:Plb1	UTSW	5	32353697	missense	possibly damaging	0.91
R1900:Plb1	UTSW	5	32286847	missense	probably benign	0.44
R1903:Plb1	UTSW	5	32291238	missense	probably damaging	1.00
R2101:Plb1	UTSW	5	32349660	missense	probably damaging	1.00
R2153:Plb1	UTSW	5	32314089	missense	probably damaging	1.00
R2207:Plb1	UTSW	5	32316640	missense	possibly damaging	0.50
R2270:Plb1	UTSW	5	32293242	missense	probably damaging	1.00
R2271:Plb1	UTSW	5	32293242	missense	probably damaging	1.00
R2311:Plb1	UTSW	5	32269818	missense	probably benign	0.01
R2850:Plb1	UTSW	5	32293224	missense	probably benign
R4444:Plb1	UTSW	5	32330565	missense	probably benign	0.06
R4559:Plb1	UTSW	5	32332831	missense	probably damaging	0.99
R4577:Plb1	UTSW	5	32247557	nonsense	probably null
R4578:Plb1	UTSW	5	32247557	nonsense	probably null
R4739:Plb1	UTSW	5	32349679	splice site	probably null
R4747:Plb1	UTSW	5	32349659	missense	probably benign	0.08
R4806:Plb1	UTSW	5	32289852	missense	probably damaging	1.00
R5406:Plb1	UTSW	5	32341915	missense	probably damaging	1.00
R5567:Plb1	UTSW	5	32364199	missense	unknown
R5574:Plb1	UTSW	5	32329947	missense	probably benign	0.13
R5588:Plb1	UTSW	5	32329949	critical splice donor site	probably null
R5619:Plb1	UTSW	5	32333497	missense	probably damaging	0.99
R5769:Plb1	UTSW	5	32317522	missense	probably benign	0.05
R6366:Plb1	UTSW	5	32314085	missense	possibly damaging	0.59
R6700:Plb1	UTSW	5	32333464	missense	probably damaging	0.99
R7162:Plb1	UTSW	5	32349663	missense	probably benign	0.30
R7379:Plb1	UTSW	5	32345639	missense	probably damaging	1.00
R7395:Plb1	UTSW	5	32353684	missense	probably benign	0.30
R7426:Plb1	UTSW	5	32321247	splice site	probably null
R7643:Plb1	UTSW	5	32247557	nonsense	probably null
R7657:Plb1	UTSW	5	32329867	missense	probably damaging	0.98
R7780:Plb1	UTSW	5	32326266	splice site	probably null
R8040:Plb1	UTSW	5	32273069	missense	possibly damaging	0.89
R8212:Plb1	UTSW	5	32264906	missense	probably damaging	1.00
R8312:Plb1	UTSW	5	32328485	missense	probably damaging	1.00
R8560:Plb1	UTSW	5	32302679	missense	possibly damaging	0.95
R8770:Plb1	UTSW	5	32247509	missense	unknown
R8857:Plb1	UTSW	5	32364212	missense	unknown
R9029:Plb1	UTSW	5	32281735	missense	probably damaging	0.99
R9110:Plb1	UTSW	5	32364058	missense	probably benign	0.00
R9765:Plb1	UTSW	5	32355387	missense	probably damaging	1.00
X0018:Plb1	UTSW	5	32285883	missense	probably benign	0.01
X0019:Plb1	UTSW	5	32353697	missense	probably damaging	0.99
X0027:Plb1	UTSW	5	32270358	missense	probably benign
X0028:Plb1	UTSW	5	32302675	missense	probably damaging	1.00
Z1088:Plb1	UTSW	5	32310847	missense	probably damaging	0.99
Z1088:Plb1	UTSW	5	32310917	missense	probably benign
Z1177:Plb1	UTSW	5	32284897	missense	possibly damaging	0.91

Predicted Primers

PCR Primer
(F):5'- CAGTCTCTCCAACAGTAGCC -3'
(R):5'- ACAGCAAGAACCTCAAAGTTGATG -3'

Sequencing Primer
(F):5'- TCCAACAGTAGCCCCTGTG -3'
(R):5'- TTATAGACCAGGATCTTAGCAACAGG -3'

Posted On

2015-02-05