Mutagenetix > Incidental Mutation

Incidental Mutation 'R3822:Xpnpep1'

275246

Institutional Source

Beutler Lab

Gene Symbol

Xpnpep1

Ensembl Gene

ENSMUSG00000025027

Gene Name

X-prolyl aminopeptidase (aminopeptidase P) 1, soluble

Synonyms

D230045I08Rik

MMRRC Submission

040884-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R3822 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

52943417-53040214 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

G to A at 53003819 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000138233 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000182500] [ENSMUST00000183108] [ENSMUST00000183274]

AlphaFold

Q6P1B1

Predicted Effect

probably benign
Transcript: ENSMUST00000069988

SMART Domains

Protein: ENSMUSP00000070946
Gene: ENSMUSG00000025027

Domain	Start	End	E-Value	Type
Pfam:Creatinase_N	10	154	5.2e-15	PFAM
Pfam:Creatinase_N_2	157	326	1.4e-47	PFAM
Pfam:Peptidase_M24	328	544	7.2e-52	PFAM
Pfam:Peptidase_M24_C	555	619	7.3e-26	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000182500

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182877

Predicted Effect

probably benign
Transcript: ENSMUST00000183108

SMART Domains

Protein: ENSMUSP00000138250
Gene: ENSMUSG00000025027

Domain	Start	End	E-Value	Type
Pfam:Creatinase_N	53	198	1.2e-17	PFAM
Pfam:Peptidase_M24	371	587	5.5e-49	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183188

Predicted Effect

probably benign
Transcript: ENSMUST00000183274

SMART Domains

Protein: ENSMUSP00000138233
Gene: ENSMUSG00000025027

Domain	Start	End	E-Value	Type
Pfam:Creatinase_N	53	198	1.2e-17	PFAM
Pfam:Peptidase_M24	371	587	1.9e-48	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.6%
20x: 95.9%

Validation Efficiency

100% (34/34)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the cytosolic form of a metalloaminopeptidase that catalyzes the cleavage of the N-terminal amino acid adjacent to a proline residue. The gene product may play a role in degradation and maturation of tachykinins, neuropeptides, and peptide hormones. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit pre and postnatal lethality, reduced male survival, growth retardation with decreased body weight, size and length, microcephaly and peptiduria. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aarsd1	T	A	11: 101,411,145	I332F	probably damaging	Het
Acpp	G	T	9: 104,324,717	Q76K	probably damaging	Het
Anp32e	A	T	3: 95,934,869	I100L	probably benign	Het
Ccdc13	C	A	9: 121,831,019	L76F	probably damaging	Het
Cd44	T	C	2: 102,901,393		probably null	Het
Chka	A	G	19: 3,882,038		probably benign	Het
Cnot6	A	T	11: 49,689,172	S98T	probably benign	Het
Cth	A	G	3: 157,918,499	F127S	probably benign	Het
Dnah9	C	A	11: 65,851,003		probably null	Het
Dysf	T	C	6: 84,207,088		probably benign	Het
Fam196b	T	C	11: 34,403,007	S350P	probably benign	Het
Flad1	T	A	3: 89,411,187	I20F	probably damaging	Het
Gm20730	C	T	6: 43,081,722	S52N	probably benign	Het
Gpr89	A	G	3: 96,892,944	S113P	probably benign	Het
Herpud2	G	A	9: 25,124,924	Q147*	probably null	Het
Hivep1	A	T	13: 42,184,311	H2622L	possibly damaging	Het
Hlcs	T	C	16: 94,267,981	N274D	probably benign	Het
Ido2	T	C	8: 24,533,755	I356V	probably benign	Het
Itgam	A	G	7: 128,112,286		probably null	Het
Lama1	C	A	17: 67,779,046		probably null	Het
Lrrc4b	T	A	7: 44,462,558	V618E	probably damaging	Het
Man1a2	A	G	3: 100,632,597	I176T	possibly damaging	Het
Mns1	A	G	9: 72,439,448	E71G	probably damaging	Het
Ncoa6	T	A	2: 155,406,938	N1482I	probably damaging	Het
Neto2	C	A	8: 85,663,295	E180*	probably null	Het
Psmb7	A	T	2: 38,613,428		probably benign	Het
Rin2	C	T	2: 145,822,630	T60M	probably benign	Het
Slc28a3	A	G	13: 58,558,278	V639A	probably benign	Het
Tenm2	A	T	11: 36,024,320	I2129N	probably damaging	Het
Topaz1	A	G	9: 122,797,783	D1492G	possibly damaging	Het
Trank1	G	A	9: 111,378,819	G1711R	probably damaging	Het
Trpm1	A	G	7: 64,217,703		probably benign	Het
Ugt1a6a	T	A	1: 88,138,529	V19E	probably benign	Het
Vmn2r60	A	T	7: 42,135,701	E112D	probably damaging	Het
Wdr4	T	G	17: 31,512,221	Q55P	probably damaging	Het
Zfyve16	A	T	13: 92,521,261	L714Q	probably damaging	Het

Other mutations in Xpnpep1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00572:Xpnpep1	APN	19	53010148	missense	probably benign	0.06
IGL01665:Xpnpep1	APN	19	52997032	missense	probably benign	0.00
IGL01833:Xpnpep1	APN	19	53000393	missense	probably damaging	1.00
IGL02011:Xpnpep1	APN	19	53002465	critical splice donor site	probably benign	0.00
IGL03229:Xpnpep1	APN	19	53025380	missense	probably benign
IGL03334:Xpnpep1	APN	19	53010146	missense	probably damaging	1.00
R0226:Xpnpep1	UTSW	19	53010152	missense	probably benign	0.03
R0613:Xpnpep1	UTSW	19	53006353	missense	probably damaging	0.97
R0648:Xpnpep1	UTSW	19	52997863	splice site	probably benign
R1543:Xpnpep1	UTSW	19	52991676	missense	probably benign	0.24
R1553:Xpnpep1	UTSW	19	53006338	missense	probably benign	0.00
R1801:Xpnpep1	UTSW	19	53010133	missense	probably damaging	1.00
R1853:Xpnpep1	UTSW	19	53006210	missense	probably benign	0.01
R2234:Xpnpep1	UTSW	19	53013461	missense	probably damaging	1.00
R3797:Xpnpep1	UTSW	19	53006342	missense	probably benign	0.28
R3820:Xpnpep1	UTSW	19	53003819	splice site	probably benign
R3925:Xpnpep1	UTSW	19	52991697	missense	probably damaging	1.00
R4831:Xpnpep1	UTSW	19	53014622	missense	probably benign	0.09
R5033:Xpnpep1	UTSW	19	53006175	missense	probably benign
R5184:Xpnpep1	UTSW	19	53013414	missense	probably benign	0.24
R5468:Xpnpep1	UTSW	19	52995519	missense	probably benign	0.01
R5573:Xpnpep1	UTSW	19	53004822	missense	probably damaging	1.00
R5876:Xpnpep1	UTSW	19	52997008	missense	probably damaging	1.00
R5929:Xpnpep1	UTSW	19	53013489	missense	probably damaging	1.00
R6454:Xpnpep1	UTSW	19	52997879	missense	possibly damaging	0.91
R6519:Xpnpep1	UTSW	19	53011844	missense	possibly damaging	0.90
R7095:Xpnpep1	UTSW	19	53011765	critical splice donor site	probably null
R7112:Xpnpep1	UTSW	19	53010107	missense	probably benign
R7412:Xpnpep1	UTSW	19	53006291	missense	probably benign
R8329:Xpnpep1	UTSW	19	53002472	critical splice donor site	probably null
R8431:Xpnpep1	UTSW	19	52995506	missense	probably benign	0.04
R9194:Xpnpep1	UTSW	19	53011858	missense	possibly damaging	0.68
R9342:Xpnpep1	UTSW	19	53004817	missense	probably benign	0.02
R9388:Xpnpep1	UTSW	19	53004802	missense	probably damaging	1.00
R9546:Xpnpep1	UTSW	19	53002528	missense	probably damaging	1.00
R9746:Xpnpep1	UTSW	19	53013461	missense	probably damaging	1.00
RF017:Xpnpep1	UTSW	19	53032060	missense	probably benign	0.21

Predicted Primers

PCR Primer
(F):5'- GACTCTCTAACACGGATGCAC -3'
(R):5'- CCAGTAATGGGAAGTGCTACAG -3'

Sequencing Primer
(F):5'- TCTAACACGGATGCACAGACTTATAG -3'
(R):5'- TGCTACAGAAGGCTTCCAGG -3'

Posted On

2015-04-02