Incidental Mutation 'R3966:Nfat5'
ID312355
Institutional Source Beutler Lab
Gene Symbol Nfat5
Ensembl Gene ENSMUSG00000003847
Gene Namenuclear factor of activated T cells 5
SynonymsOREBP, nfatz, TonEBP, B130038B15Rik
MMRRC Submission 040935-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.935) question?
Stock #R3966 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location107293470-107379517 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 107367289 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 721 (A721S)
Ref Sequence ENSEMBL: ENSMUSP00000127784 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075922] [ENSMUST00000077440] [ENSMUST00000125721] [ENSMUST00000133026] [ENSMUST00000144100] [ENSMUST00000147588] [ENSMUST00000151114] [ENSMUST00000154474] [ENSMUST00000169453]
Predicted Effect probably benign
Transcript: ENSMUST00000075922
AA Change: A703S

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000075311
Gene: ENSMUSG00000003847
AA Change: A703S

DomainStartEndE-ValueType
low complexity region 52 98 N/A INTRINSIC
low complexity region 179 192 N/A INTRINSIC
Pfam:RHD 282 439 7.8e-23 PFAM
IPT 444 542 3.33e-15 SMART
low complexity region 647 653 N/A INTRINSIC
low complexity region 734 754 N/A INTRINSIC
low complexity region 793 810 N/A INTRINSIC
low complexity region 898 910 N/A INTRINSIC
low complexity region 915 920 N/A INTRINSIC
low complexity region 963 977 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000077440
AA Change: A627S

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000076653
Gene: ENSMUSG00000003847
AA Change: A627S

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
low complexity region 103 116 N/A INTRINSIC
Pfam:RHD 206 363 1.5e-22 PFAM
IPT 368 466 3.33e-15 SMART
low complexity region 571 577 N/A INTRINSIC
low complexity region 658 678 N/A INTRINSIC
low complexity region 717 734 N/A INTRINSIC
low complexity region 822 834 N/A INTRINSIC
low complexity region 839 844 N/A INTRINSIC
low complexity region 887 901 N/A INTRINSIC
internal_repeat_2 927 1110 7.13e-8 PROSPERO
internal_repeat_1 935 1128 2.59e-11 PROSPERO
internal_repeat_2 1122 1324 7.13e-8 PROSPERO
internal_repeat_1 1207 1426 2.59e-11 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000125721
AA Change: A703S

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000116094
Gene: ENSMUSG00000003847
AA Change: A703S

DomainStartEndE-ValueType
low complexity region 52 98 N/A INTRINSIC
low complexity region 179 192 N/A INTRINSIC
Pfam:RHD 282 439 1e-22 PFAM
IPT 444 542 3.33e-15 SMART
low complexity region 647 653 N/A INTRINSIC
low complexity region 734 754 N/A INTRINSIC
low complexity region 793 810 N/A INTRINSIC
low complexity region 898 910 N/A INTRINSIC
low complexity region 915 920 N/A INTRINSIC
low complexity region 963 977 N/A INTRINSIC
internal_repeat_2 1003 1186 2.22e-8 PROSPERO
internal_repeat_1 1011 1204 5.31e-12 PROSPERO
internal_repeat_2 1198 1400 2.22e-8 PROSPERO
internal_repeat_1 1283 1502 5.31e-12 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126397
Predicted Effect probably benign
Transcript: ENSMUST00000133026
SMART Domains Protein: ENSMUSP00000116631
Gene: ENSMUSG00000003847

DomainStartEndE-ValueType
low complexity region 70 88 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144100
Predicted Effect probably benign
Transcript: ENSMUST00000147588
AA Change: A202S

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000122871
Gene: ENSMUSG00000003847
AA Change: A202S

DomainStartEndE-ValueType
Blast:IPT 1 42 3e-20 BLAST
PDB:1IMH|D 1 44 2e-20 PDB
SCOP:d1bfta_ 1 44 3e-14 SMART
low complexity region 146 152 N/A INTRINSIC
low complexity region 233 253 N/A INTRINSIC
low complexity region 292 309 N/A INTRINSIC
low complexity region 397 409 N/A INTRINSIC
low complexity region 414 419 N/A INTRINSIC
low complexity region 462 476 N/A INTRINSIC
internal_repeat_2 502 685 1.17e-6 PROSPERO
internal_repeat_1 510 703 1.39e-9 PROSPERO
internal_repeat_2 697 899 1.17e-6 PROSPERO
internal_repeat_1 782 1001 1.39e-9 PROSPERO
Predicted Effect possibly damaging
Transcript: ENSMUST00000151114
AA Change: A721S

PolyPhen 2 Score 0.471 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000119370
Gene: ENSMUSG00000003847
AA Change: A721S

DomainStartEndE-ValueType
low complexity region 70 116 N/A INTRINSIC
low complexity region 197 210 N/A INTRINSIC
Pfam:RHD_DNA_bind 300 457 1.1e-22 PFAM
IPT 462 560 3.33e-15 SMART
low complexity region 665 671 N/A INTRINSIC
low complexity region 752 772 N/A INTRINSIC
low complexity region 811 828 N/A INTRINSIC
low complexity region 916 928 N/A INTRINSIC
low complexity region 933 938 N/A INTRINSIC
low complexity region 981 995 N/A INTRINSIC
internal_repeat_2 1021 1204 2.24e-8 PROSPERO
internal_repeat_1 1029 1222 5.32e-12 PROSPERO
internal_repeat_2 1216 1418 2.24e-8 PROSPERO
internal_repeat_1 1301 1520 5.32e-12 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000154474
SMART Domains Protein: ENSMUSP00000115036
Gene: ENSMUSG00000003847

DomainStartEndE-ValueType
low complexity region 52 70 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000169453
AA Change: A721S

PolyPhen 2 Score 0.471 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000127784
Gene: ENSMUSG00000003847
AA Change: A721S

DomainStartEndE-ValueType
low complexity region 70 116 N/A INTRINSIC
low complexity region 197 210 N/A INTRINSIC
Pfam:RHD_DNA_bind 300 457 1.1e-22 PFAM
IPT 462 560 3.33e-15 SMART
low complexity region 665 671 N/A INTRINSIC
low complexity region 752 772 N/A INTRINSIC
low complexity region 811 828 N/A INTRINSIC
low complexity region 916 928 N/A INTRINSIC
low complexity region 933 938 N/A INTRINSIC
low complexity region 981 995 N/A INTRINSIC
internal_repeat_2 1021 1204 2.24e-8 PROSPERO
internal_repeat_1 1029 1222 5.32e-12 PROSPERO
internal_repeat_2 1216 1418 2.24e-8 PROSPERO
internal_repeat_1 1301 1520 5.32e-12 PROSPERO
Meta Mutation Damage Score 0.0584 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a member of the nuclear factors of activated T cells family of transcription factors. Proteins belonging to this family play a central role in inducible gene transcription during the immune response. This protein regulates gene expression induced by osmotic stress in mammalian cells. Unlike monomeric members of this protein family, this protein exists as a homodimer and forms stable dimers with DNA elements. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for one of several knock-out allele exhibit lethality between E14.5 and E17.5 as well as around P10 with kidney, cardiac or immune defects depending on the allele. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530099J19Rik A G 13: 19,729,444 noncoding transcript Het
Agap1 T C 1: 89,834,461 I371T probably damaging Het
Brwd1 G A 16: 96,044,530 T731I probably damaging Het
C1galt1c1 A T X: 38,631,576 V181E probably benign Het
C3 A G 17: 57,218,664 V864A probably damaging Het
Cadps A T 14: 12,522,161 probably null Het
Cemip T A 7: 83,951,509 Y968F probably benign Het
Ces1g C A 8: 93,328,511 R186L possibly damaging Het
Chd2 A G 7: 73,464,395 probably benign Het
Clptm1l T C 13: 73,615,972 Y404H probably damaging Het
CN725425 T A 15: 91,242,687 probably null Het
Ctc1 T A 11: 69,031,128 V800D probably damaging Het
Cyp1a1 T A 9: 57,700,149 V20D probably benign Het
E330034G19Rik G T 14: 24,306,871 M158I unknown Het
Ehbp1l1 C T 19: 5,710,573 probably null Het
Gm12169 T A 11: 46,535,513 V149D possibly damaging Het
Gm14137 T A 2: 119,175,016 S19T probably benign Het
Gprc6a CAAA CA 10: 51,615,680 probably null Het
Inhbb C A 1: 119,417,561 G333W probably damaging Het
Kcnb1 C T 2: 167,104,492 C812Y probably damaging Het
Kdm4c A G 4: 74,298,583 D193G probably damaging Het
Mbd5 A T 2: 49,272,070 I855L possibly damaging Het
Mcpt1 G A 14: 56,019,046 V80M probably benign Het
Med31 C T 11: 72,211,929 A118T probably benign Het
Megf10 A G 18: 57,180,574 D30G probably damaging Het
Ms4a6b T C 19: 11,521,734 S71P probably benign Het
Muc2 G A 7: 141,699,664 R120H probably benign Het
Mycbp2 A G 14: 103,138,725 probably benign Het
Myrf T C 19: 10,219,615 E267G probably benign Het
Ncor1 T C 11: 62,344,757 T624A probably damaging Het
Nfatc2 C T 2: 168,504,549 S875N probably benign Het
Npm1 C T 11: 33,160,350 G148D probably benign Het
Nrap T C 19: 56,342,144 S1126G probably damaging Het
Nucb2 A G 7: 116,528,875 E273G probably damaging Het
Prkd1 C T 12: 50,392,941 E368K probably benign Het
Ptgs2 T A 1: 150,105,475 I503N probably damaging Het
Qrfpr A G 3: 36,181,000 S243P possibly damaging Het
Safb2 T C 17: 56,575,356 S426G probably null Het
Sos1 C T 17: 80,455,179 R73H probably damaging Het
Spink10 T C 18: 62,657,904 I87T probably damaging Het
Tet2 A G 3: 133,487,657 S339P possibly damaging Het
Tmx4 T C 2: 134,600,061 I206V possibly damaging Het
Tom1 A G 8: 75,059,239 K360E probably benign Het
Trp73 A G 4: 154,062,036 V422A probably benign Het
Vmn2r33 T C 7: 7,554,169 M511V probably benign Het
Zfp628 T C 7: 4,921,745 S989P probably benign Het
Other mutations in Nfat5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01019:Nfat5 APN 8 107367514 missense probably damaging 1.00
IGL01145:Nfat5 APN 8 107367215 missense probably damaging 0.99
IGL01700:Nfat5 APN 8 107339130 missense probably damaging 0.99
IGL01721:Nfat5 APN 8 107344979 critical splice donor site probably null
IGL01796:Nfat5 APN 8 107367641 missense probably damaging 1.00
IGL01976:Nfat5 APN 8 107367559 missense probably damaging 1.00
IGL02063:Nfat5 APN 8 107361818 missense probably benign 0.03
IGL02150:Nfat5 APN 8 107367952 nonsense probably null
IGL02174:Nfat5 APN 8 107339051 missense probably damaging 1.00
IGL02224:Nfat5 APN 8 107344815 missense probably benign 0.00
IGL02226:Nfat5 APN 8 107351522 nonsense probably null
IGL02324:Nfat5 APN 8 107366176 splice site probably benign
IGL02724:Nfat5 APN 8 107358735 missense probably damaging 0.97
fettfeld UTSW 8 107347727 missense probably damaging 1.00
Grunefeld UTSW 8 107355508 splice site probably null
Kleinfeld UTSW 8 107351438 missense probably damaging 1.00
viola UTSW 8 107358668 missense probably damaging 1.00
H8562:Nfat5 UTSW 8 107339382 splice site probably benign
R0003:Nfat5 UTSW 8 107339075 missense probably damaging 1.00
R0117:Nfat5 UTSW 8 107339075 missense probably damaging 1.00
R0118:Nfat5 UTSW 8 107339075 missense probably damaging 1.00
R0119:Nfat5 UTSW 8 107339075 missense probably damaging 1.00
R0135:Nfat5 UTSW 8 107339075 missense probably damaging 1.00
R0138:Nfat5 UTSW 8 107339075 missense probably damaging 1.00
R0141:Nfat5 UTSW 8 107339075 missense probably damaging 1.00
R0302:Nfat5 UTSW 8 107358701 missense probably damaging 1.00
R0420:Nfat5 UTSW 8 107367461 missense probably damaging 1.00
R0613:Nfat5 UTSW 8 107366295 missense possibly damaging 0.83
R0691:Nfat5 UTSW 8 107355605 missense probably damaging 1.00
R0743:Nfat5 UTSW 8 107368066 missense probably damaging 1.00
R1329:Nfat5 UTSW 8 107369027 missense probably benign 0.42
R1550:Nfat5 UTSW 8 107370573 missense probably damaging 0.99
R1590:Nfat5 UTSW 8 107293890 missense probably damaging 1.00
R1778:Nfat5 UTSW 8 107361789 missense probably damaging 1.00
R1827:Nfat5 UTSW 8 107367334 missense probably benign 0.00
R1918:Nfat5 UTSW 8 107366236 missense probably damaging 0.97
R2679:Nfat5 UTSW 8 107344914 missense probably damaging 1.00
R2850:Nfat5 UTSW 8 107293860 missense probably damaging 1.00
R3703:Nfat5 UTSW 8 107351421 splice site probably benign
R4301:Nfat5 UTSW 8 107355695 intron probably benign
R4596:Nfat5 UTSW 8 107351500 missense possibly damaging 0.93
R4602:Nfat5 UTSW 8 107367223 nonsense probably null
R4627:Nfat5 UTSW 8 107369276 missense probably damaging 1.00
R4917:Nfat5 UTSW 8 107324652 missense probably damaging 1.00
R4918:Nfat5 UTSW 8 107324652 missense probably damaging 1.00
R5089:Nfat5 UTSW 8 107351438 missense probably damaging 1.00
R5495:Nfat5 UTSW 8 107368447 missense probably benign 0.03
R5566:Nfat5 UTSW 8 107369135 missense possibly damaging 0.47
R5851:Nfat5 UTSW 8 107347727 missense probably damaging 1.00
R6012:Nfat5 UTSW 8 107367133 missense probably benign 0.09
R6018:Nfat5 UTSW 8 107355651 critical splice donor site probably null
R6364:Nfat5 UTSW 8 107368277 missense probably benign 0.00
R6404:Nfat5 UTSW 8 107370588 missense probably benign 0.01
R6466:Nfat5 UTSW 8 107355508 splice site probably null
R7056:Nfat5 UTSW 8 107368106 missense probably damaging 1.00
R7105:Nfat5 UTSW 8 107369191 missense possibly damaging 0.88
R7128:Nfat5 UTSW 8 107358691 missense probably benign 0.10
R7214:Nfat5 UTSW 8 107293883 missense probably damaging 0.99
R7276:Nfat5 UTSW 8 107367099 missense probably benign 0.25
R7560:Nfat5 UTSW 8 107370589 missense probably benign 0.15
R7844:Nfat5 UTSW 8 107358668 missense probably damaging 1.00
R7993:Nfat5 UTSW 8 107355502 splice site probably null
R8407:Nfat5 UTSW 8 107367415 nonsense probably null
R8428:Nfat5 UTSW 8 107368520 missense probably damaging 0.96
R8798:Nfat5 UTSW 8 107347689 missense probably damaging 1.00
X0022:Nfat5 UTSW 8 107347756 nonsense probably null
Z1177:Nfat5 UTSW 8 107338842 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGCATTGGATCAACCCAGC -3'
(R):5'- TAGTACTCTGGAGCTGGCTGAC -3'

Sequencing Primer
(F):5'- ACTATTTCTAACATAGCGGGGG -3'
(R):5'- AGCTGGCTGACACTGCTTG -3'
Posted On2015-04-29