Incidental Mutation 'R4049:Eral1'
ID314054
Institutional Source Beutler Lab
Gene Symbol Eral1
Ensembl Gene ENSMUSG00000020832
Gene NameEra (G-protein)-like 1 (E. coli)
Synonyms2610524P08Rik, 9130407C09Rik, MERA-W, MERA-S
MMRRC Submission 041616-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4049 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location78073376-78080383 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 78075602 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 250 (L250P)
Ref Sequence ENSEMBL: ENSMUSP00000021183 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021183]
Predicted Effect probably damaging
Transcript: ENSMUST00000021183
AA Change: L250P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021183
Gene: ENSMUSG00000020832
AA Change: L250P

DomainStartEndE-ValueType
low complexity region 79 92 N/A INTRINSIC
Pfam:AIG1 114 249 2.2e-11 PFAM
Pfam:FeoB_N 114 260 5e-10 PFAM
Pfam:MMR_HSR1 115 237 4e-21 PFAM
Pfam:Dynamin_N 116 162 1.6e-6 PFAM
Pfam:KH_2 363 437 6.3e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083467
Predicted Effect noncoding transcript
Transcript: ENSMUST00000093557
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135154
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139731
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196157
Meta Mutation Damage Score 0.8873 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a GTPase that localizes to the mitochondrion. The encoded protein binds to the 3' terminal stem loop of 12S mitochondrial rRNA and is required for proper assembly of the 28S small mitochondrial ribosomal subunit. Deletion of this gene has been shown to cause mitochondrial dysfunction, growth retardation, and apoptosis. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 T A 12: 118,868,669 E1190V probably damaging Het
Arhgef10 A G 8: 14,979,998 T928A probably benign Het
Arhgef10l T A 4: 140,515,451 I836F probably benign Het
Blm T A 7: 80,502,862 T446S probably benign Het
Ccdc63 T A 5: 122,122,750 Q237L probably damaging Het
Cep57l1 G T 10: 41,729,360 R130S probably damaging Het
Clstn2 T G 9: 97,457,560 E786A possibly damaging Het
Col16a1 C T 4: 130,068,752 P540L probably damaging Het
Csf2 A G 11: 54,249,333 F61L probably damaging Het
Ctr9 C T 7: 111,055,543 R1094C unknown Het
Cyp3a41a A G 5: 145,713,540 C98R probably damaging Het
Dthd1 T A 5: 62,827,165 C404* probably null Het
Egfem1 A C 3: 29,686,731 H518P probably benign Het
Elf3 T C 1: 135,254,277 S369G probably benign Het
Eml6 C T 11: 29,838,577 V503M probably damaging Het
Enthd1 T C 15: 80,560,039 D105G probably damaging Het
Gdf15 A T 8: 70,629,955 M167K probably benign Het
Ggps1 T C 13: 14,053,699 K300E probably benign Het
Gm8074 G A 9: 78,322,336 noncoding transcript Het
Herc3 A G 6: 58,876,837 I623V probably damaging Het
Mad1l1 A G 5: 140,132,816 S457P probably damaging Het
Map1lc3a G T 2: 155,277,542 V91F possibly damaging Het
Map4k3 A G 17: 80,605,965 V617A probably benign Het
Mov10l1 T A 15: 88,995,032 probably benign Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Ncor1 G T 11: 62,329,668 probably null Het
Nfe2 C T 15: 103,250,937 E36K possibly damaging Het
Olfr1176 T C 2: 88,343,800 probably null Het
Olfr1212 A G 2: 88,959,273 K269R probably benign Het
Olfr1251 T C 2: 89,667,662 I75V probably benign Het
Olfr653 T C 7: 104,580,368 F241L probably benign Het
Oprm1 G A 10: 6,829,087 V95I probably benign Het
Pcdha9 T A 18: 36,997,942 H21Q probably benign Het
Pcolce2 A T 9: 95,638,755 I62F probably damaging Het
Pfpl T A 19: 12,429,689 C435S probably damaging Het
Pkhd1l1 G A 15: 44,498,557 C542Y probably damaging Het
Plekha5 T C 6: 140,583,871 S75P probably damaging Het
Pphln1 C A 15: 93,465,106 A202E probably damaging Het
Ppp1r1a A G 15: 103,532,454 L92P probably damaging Het
Prokr2 T C 2: 132,381,494 T43A probably benign Het
Rai14 T C 15: 10,592,212 N199S probably benign Het
Rasgrp2 T C 19: 6,404,727 L199P probably damaging Het
Rnf213 A C 11: 119,482,448 M4939L possibly damaging Het
Slc23a2 C T 2: 132,060,683 R533Q probably benign Het
Slc7a7 T C 14: 54,373,091 probably null Het
Snrpd2 T A 7: 19,151,307 V31E probably damaging Het
Spire1 G T 18: 67,529,031 probably null Het
Srsf4 T C 4: 131,900,543 probably benign Het
Tcf20 A G 15: 82,853,429 S1274P probably damaging Het
Tcof1 C A 18: 60,832,903 A376S possibly damaging Het
Thsd1 T A 8: 22,243,164 Y76N possibly damaging Het
Timm44 A G 8: 4,260,561 V397A probably benign Het
Tmc6 G A 11: 117,778,261 T89I possibly damaging Het
Trbv31 C A 6: 41,557,705 C107F probably damaging Het
Trim37 T A 11: 87,140,603 probably null Het
Ttll5 T C 12: 86,012,799 V1226A probably benign Het
Ube3b T C 5: 114,412,870 V865A probably benign Het
Vmn2r86 A T 10: 130,447,097 M550K probably damaging Het
Vps54 C A 11: 21,300,183 T373N probably benign Het
Wdr64 T G 1: 175,805,856 I891S probably benign Het
Wisp2 A G 2: 163,828,984 D137G probably damaging Het
Zfhx4 C T 3: 5,398,859 S1384L probably damaging Het
Zfp703 A G 8: 26,979,085 E259G possibly damaging Het
Zfp933 T C 4: 147,826,512 H209R probably damaging Het
Zfp980 A G 4: 145,702,600 H633R probably damaging Het
Other mutations in Eral1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01478:Eral1 APN 11 78075732 missense probably damaging 1.00
IGL01643:Eral1 APN 11 78074278 critical splice donor site probably null
IGL02240:Eral1 APN 11 78077861 nonsense probably null
IGL03085:Eral1 APN 11 78078267 missense probably damaging 1.00
K3955:Eral1 UTSW 11 78076021 missense probably damaging 1.00
P0038:Eral1 UTSW 11 78076021 missense probably damaging 1.00
R0240:Eral1 UTSW 11 78076058 splice site probably benign
R1084:Eral1 UTSW 11 78074498 missense probably damaging 0.96
R1563:Eral1 UTSW 11 78075406 missense probably benign 0.39
R1881:Eral1 UTSW 11 78076049 missense possibly damaging 0.67
R1995:Eral1 UTSW 11 78074489 missense probably benign
R2189:Eral1 UTSW 11 78075831 missense probably benign 0.15
R2870:Eral1 UTSW 11 78076278 missense possibly damaging 0.95
R2870:Eral1 UTSW 11 78076278 missense possibly damaging 0.95
R4585:Eral1 UTSW 11 78078304 missense probably damaging 1.00
R4586:Eral1 UTSW 11 78078304 missense probably damaging 1.00
R4758:Eral1 UTSW 11 78075599 missense probably benign 0.20
R5450:Eral1 UTSW 11 78078357 missense probably benign 0.23
R5613:Eral1 UTSW 11 78074404 intron probably benign
R5987:Eral1 UTSW 11 78080233 missense possibly damaging 0.90
R6048:Eral1 UTSW 11 78075783 missense probably benign 0.03
R6363:Eral1 UTSW 11 78074317 missense probably damaging 1.00
R6891:Eral1 UTSW 11 78075733 missense possibly damaging 0.76
R7384:Eral1 UTSW 11 78074101 missense possibly damaging 0.81
R7468:Eral1 UTSW 11 78075393 missense probably damaging 1.00
R7762:Eral1 UTSW 11 78074533 missense possibly damaging 0.94
X0066:Eral1 UTSW 11 78075765 missense probably damaging 1.00
Z1176:Eral1 UTSW 11 78075620 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCAAGGCTAACTGACCTTC -3'
(R):5'- TGCAGTGCTTGACCAAGTTC -3'

Sequencing Primer
(F):5'- GCAAGGCTAACTGACCTTCAATGTG -3'
(R):5'- AGTGCTTGACCAAGTTCTCTCAGG -3'
Posted On2015-04-30