Mutagenetix > Incidental Mutation

Incidental Mutation 'R4072:Axl'

316338

Institutional Source

Beutler Lab

Gene Symbol

Axl

Ensembl Gene

ENSMUSG00000002602

Gene Name

AXL receptor tyrosine kinase

Synonyms

Tyro7, Ufo, Ark

MMRRC Submission

040854-MU

Accession Numbers

Genbank: NM_009465; MGI: 1347244

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4072 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

25757273-25788705 bp(-) (GRCm38)

Type of Mutation

unclassified

DNA Base Change (assembly)

A to G at 25763911 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s): [ENSMUST00000002677] [ENSMUST00000085948]

AlphaFold

Q00993

Predicted Effect

probably benign
Transcript: ENSMUST00000002677

SMART Domains

Protein: ENSMUSP00000002677
Gene: ENSMUSG00000002602

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
IG	35	124	5.53e-6	SMART
IG	139	218	9.06e-2	SMART
FN3	219	312	9.25e-6	SMART
FN3	328	409	2.18e-2	SMART
transmembrane domain	444	466	N/A	INTRINSIC
low complexity region	489	501	N/A	INTRINSIC
TyrKc	530	797	1.91e-134	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000085948

SMART Domains

Protein: ENSMUSP00000083110
Gene: ENSMUSG00000002602

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
IG	35	124	5.53e-6	SMART
IG	139	218	9.06e-2	SMART
FN3	219	312	9.25e-6	SMART
FN3	328	409	2.18e-2	SMART
transmembrane domain	435	457	N/A	INTRINSIC
low complexity region	480	492	N/A	INTRINSIC
TyrKc	521	788	1.91e-134	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124442

Predicted Effect

probably benign
Transcript: ENSMUST00000132038

SMART Domains

Protein: ENSMUSP00000114907
Gene: ENSMUSG00000002602

Domain	Start	End	E-Value	Type
Blast:FN3	2	42	8e-20	BLAST
SCOP:d1gh7a2	2	61	4e-7	SMART
transmembrane domain	68	90	N/A	INTRINSIC
low complexity region	113	125	N/A	INTRINSIC
Pfam:Pkinase_Tyr	154	188	4.1e-6	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132989

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137211

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.6%

Validation Efficiency

98% (52/53)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Tyro3-Axl-Mer (TAM) receptor tyrosine kinase subfamily. The encoded protein possesses an extracellular domain which is composed of two immunoglobulin-like motifs at the N-terminal, followed by two fibronectin type-III motifs. It transduces signals from the extracellular matrix into the cytoplasm by binding to the vitamin K-dependent protein growth arrest-specific 6 (Gas6). This gene may be involved in several cellular functions including growth, migration, aggregation and anti-inflammation in multiple cell types. Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygous mutant mice are phenotypically normal, however in conjunction with mutations in other related receptor tyrosine kinases, mutations of this gene results in fertility defects, autoimmunity abnormalities, and aberrant apoptosis. [provided by MGI curators]

Allele List at MGI

All alleles(2) : Targeted, knock-out(1) Targeted, other(1)

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930590J08Rik	A	G	6: 91,945,361		probably null	Het
Abcc5	A	G	16: 20,333,695	I1367T	probably damaging	Het
Acsm4	T	A	7: 119,698,758	L206H	probably benign	Het
Acss3	C	T	10: 107,123,585		probably benign	Het
Ankar	G	T	1: 72,688,592	D169E	probably damaging	Het
Arfgap3	C	T	15: 83,303,129	A510T	probably damaging	Het
Atp4a	T	C	7: 30,715,332	I182T	probably benign	Het
Baz1a	A	G	12: 54,941,560	I268T	probably benign	Het
Baz2b	A	T	2: 59,912,573		probably null	Het
C2cd4d	C	A	3: 94,363,878	C150*	probably null	Het
Crtac1	T	C	19: 42,304,707	Y321C	probably damaging	Het
Dnah11	T	C	12: 118,106,492	H1526R	probably damaging	Het
Dnah5	A	T	15: 28,340,298	R2284*	probably null	Het
Dnah9	T	C	11: 66,084,904	T1440A	probably benign	Het
Eps15l1	A	G	8: 72,380,284	I482T	probably damaging	Het
Eqtn	A	G	4: 94,919,962	I201T	possibly damaging	Het
Ercc4	G	A	16: 13,130,685	V499I	probably damaging	Het
Eva1c	T	A	16: 90,904,131	F331Y	probably damaging	Het
Fcho1	T	C	8: 71,710,369	H672R	probably damaging	Het
Galntl5	A	T	5: 25,198,480	K150*	probably null	Het
Gm16427	A	T	5: 93,485,198	M50K	probably damaging	Het
Gm19965	A	G	1: 116,821,071	T161A	probably benign	Het
Gm5346	A	T	8: 43,626,350	F279Y	probably damaging	Het
Hydin	G	A	8: 110,505,256	E1617K	possibly damaging	Het
Krtap31-1	T	C	11: 99,908,232	I87T	possibly damaging	Het
Lamp3	A	G	16: 19,700,716	L239P	possibly damaging	Het
Nlrp4c	A	G	7: 6,072,710	K667E	probably benign	Het
Obox3	G	T	7: 15,625,799	T315N	possibly damaging	Het
Obscn	A	G	11: 58,997,183	I7652T	unknown	Het
Olfr1469	G	A	19: 13,410,935	R122H	possibly damaging	Het
Olfr52	T	A	2: 86,181,647	M155L	probably benign	Het
Olfr670	A	T	7: 104,960,716	N5K	probably damaging	Het
Pde7a	G	A	3: 19,256,853	R70C	probably damaging	Het
Pidd1	A	G	7: 141,440,826	F453L	probably damaging	Het
Pms2	T	C	5: 143,929,001	I742T	probably damaging	Het
Pot1a	T	C	6: 25,752,357		probably null	Het
Rp1l1	A	T	14: 64,028,132	E389V	probably damaging	Het
Scnn1a	A	G	6: 125,338,907	N407S	probably damaging	Het
Slc30a7	T	C	3: 115,946,680	D374G	probably damaging	Het
Slco2a1	T	A	9: 103,068,002	I192N	probably damaging	Het
Srp72	C	A	5: 76,998,251	T633K	probably benign	Het
Tm2d3	T	A	7: 65,697,750	L49*	probably null	Het
Tmprss11e	T	C	5: 86,715,643	T188A	possibly damaging	Het
Tox	T	C	4: 6,842,396	T45A	probably damaging	Het
Usp31	A	G	7: 121,667,782		probably null	Het
Vwc2	T	A	11: 11,116,446	L178Q	probably damaging	Het
Zbbx	C	T	3: 75,105,671	G151E	probably damaging	Het
Zbtb11	C	T	16: 55,998,064	T617I	possibly damaging	Het

Other mutations in Axl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00326:Axl	APN	7	25785899	missense	probably benign	0.16
IGL00428:Axl	APN	7	25760872	missense	probably damaging	1.00
IGL00725:Axl	APN	7	25764483	missense	probably damaging	0.97
IGL01348:Axl	APN	7	25763309	missense	probably damaging	1.00
IGL01350:Axl	APN	7	25758750	missense	probably damaging	1.00
IGL01357:Axl	APN	7	25774169	missense	probably benign	0.00
IGL02314:Axl	APN	7	25786920	missense	possibly damaging	0.50
IGL02321:Axl	APN	7	25758769	missense	probably damaging	1.00
IGL02839:Axl	APN	7	25766791	critical splice donor site	probably null
IGL02878:Axl	APN	7	25758877	missense	probably damaging	0.99
R0125:Axl	UTSW	7	25786943	missense	probably benign	0.00
R0529:Axl	UTSW	7	25787287	splice site	probably benign
R0539:Axl	UTSW	7	25778717	unclassified	probably benign
R0614:Axl	UTSW	7	25774163	missense	probably benign	0.18
R0747:Axl	UTSW	7	25764059	missense	possibly damaging	0.95
R1599:Axl	UTSW	7	25763969	missense	probably damaging	0.99
R1727:Axl	UTSW	7	25760766	missense	possibly damaging	0.68
R1880:Axl	UTSW	7	25774548	missense	probably damaging	1.00
R2206:Axl	UTSW	7	25770636	missense	probably damaging	1.00
R2513:Axl	UTSW	7	25787516	missense	probably benign
R2877:Axl	UTSW	7	25766524	missense	probably damaging	0.96
R3802:Axl	UTSW	7	25788477	start codon destroyed	probably null	0.98
R3915:Axl	UTSW	7	25760744	splice site	probably benign
R4064:Axl	UTSW	7	25764020	missense	probably benign	0.36
R4073:Axl	UTSW	7	25763911	unclassified	probably benign
R4074:Axl	UTSW	7	25763911	unclassified	probably benign
R4378:Axl	UTSW	7	25758837	missense	probably benign	0.06
R5039:Axl	UTSW	7	25785915	missense	probably damaging	1.00
R5224:Axl	UTSW	7	25786944	missense	probably benign	0.00
R5328:Axl	UTSW	7	25773411	missense	probably damaging	1.00
R5519:Axl	UTSW	7	25778662	missense	possibly damaging	0.93
R5885:Axl	UTSW	7	25766852	missense	probably damaging	1.00
R6367:Axl	UTSW	7	25787433	missense	probably damaging	1.00
R6447:Axl	UTSW	7	25770283	missense	probably damaging	0.96
R6931:Axl	UTSW	7	25761433	missense	probably damaging	1.00
R7172:Axl	UTSW	7	25786974	missense	probably benign	0.33
R7355:Axl	UTSW	7	25774106	missense	probably benign	0.22
R7410:Axl	UTSW	7	25758783	missense	probably benign	0.06
R8274:Axl	UTSW	7	25764013	missense	probably damaging	0.99
R8279:Axl	UTSW	7	25763954	missense	probably benign	0.07
R8281:Axl	UTSW	7	25763954	missense	probably benign	0.07
R8282:Axl	UTSW	7	25763954	missense	probably benign	0.07
R8283:Axl	UTSW	7	25763954	missense	probably benign	0.07
R8546:Axl	UTSW	7	25774163	missense	probably benign	0.00
R8742:Axl	UTSW	7	25764436	missense	probably damaging	0.99
R9002:Axl	UTSW	7	25778678	missense	probably damaging	0.97
R9139:Axl	UTSW	7	25761421	missense	probably damaging	1.00
R9179:Axl	UTSW	7	25770233	missense	probably damaging	0.97
R9324:Axl	UTSW	7	25761557	missense	probably damaging	1.00
R9343:Axl	UTSW	7	25774119	missense	probably damaging	1.00
R9352:Axl	UTSW	7	25763327	missense	possibly damaging	0.73
X0027:Axl	UTSW	7	25770268	missense	probably damaging	1.00
Z1177:Axl	UTSW	7	25761526	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGGTCACCCTTTCAGTCAGG -3'
(R):5'- AATAACTGATCTTCCTGGGGTGGG -3'

Sequencing Primer
(F):5'- ATTAATTCCAAGGCCACCTTATCG -3'
(R):5'- GGGGGCTCAGGCGTCTG -3'

Posted On

2015-05-15