Incidental Mutation 'R0837:Sema4a'
ID77979
Institutional Source Beutler Lab
Gene Symbol Sema4a
Ensembl Gene ENSMUSG00000028064
Gene Namesema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4A
SynonymsSemB, Semab, SemB
MMRRC Submission 039016-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.868) question?
Stock #R0837 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location88435959-88461182 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 88453098 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 58 (Q58L)
Ref Sequence ENSEMBL: ENSMUSP00000114330 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029700] [ENSMUST00000107531] [ENSMUST00000123753] [ENSMUST00000125526] [ENSMUST00000127436] [ENSMUST00000141471] [ENSMUST00000147200] [ENSMUST00000165898] [ENSMUST00000166237] [ENSMUST00000169222] [ENSMUST00000184876] [ENSMUST00000184487] [ENSMUST00000185137]
Predicted Effect probably benign
Transcript: ENSMUST00000029700
AA Change: Q58L

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000029700
Gene: ENSMUSG00000028064
AA Change: Q58L

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Sema 64 478 1.96e-166 SMART
PSI 496 547 9.33e-13 SMART
transmembrane domain 680 702 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107531
SMART Domains Protein: ENSMUSP00000103155
Gene: ENSMUSG00000028064

DomainStartEndE-ValueType
Sema 2 346 2.06e-101 SMART
PSI 364 415 9.33e-13 SMART
transmembrane domain 548 570 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123753
Predicted Effect probably benign
Transcript: ENSMUST00000125526
AA Change: Q58L

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000119028
Gene: ENSMUSG00000028064
AA Change: Q58L

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:Sema 64 113 8.2e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127436
AA Change: Q58L

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000118706
Gene: ENSMUSG00000028064
AA Change: Q58L

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:Sema 64 234 5.5e-53 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135539
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135732
Predicted Effect possibly damaging
Transcript: ENSMUST00000141471
AA Change: Q58L

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000114330
Gene: ENSMUSG00000028064
AA Change: Q58L

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146921
Predicted Effect probably benign
Transcript: ENSMUST00000147200
AA Change: Q58L

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000123061
Gene: ENSMUSG00000028064
AA Change: Q58L

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:Sema 64 203 3.5e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149145
Predicted Effect probably benign
Transcript: ENSMUST00000165898
AA Change: Q58L

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000128510
Gene: ENSMUSG00000028064
AA Change: Q58L

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Sema 64 478 1.96e-166 SMART
PSI 496 547 9.33e-13 SMART
transmembrane domain 680 702 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166237
AA Change: Q58L

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000125909
Gene: ENSMUSG00000028064
AA Change: Q58L

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Sema 64 478 1.96e-166 SMART
PSI 496 547 9.33e-13 SMART
transmembrane domain 680 702 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169222
AA Change: Q58L

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000128887
Gene: ENSMUSG00000028064
AA Change: Q58L

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Sema 64 478 1.96e-166 SMART
PSI 496 547 9.33e-13 SMART
transmembrane domain 680 702 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184876
AA Change: Q58L

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000139159
Gene: ENSMUSG00000028064
AA Change: Q58L

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:Sema 64 179 7.7e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000184487
AA Change: Q58L

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000139126
Gene: ENSMUSG00000028064
AA Change: Q58L

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:Sema 64 168 1.5e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184972
Predicted Effect probably benign
Transcript: ENSMUST00000185137
Meta Mutation Damage Score 0.0625 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency 96% (44/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the semaphorin family of soluble and transmembrane proteins. Semaphorins are involved in numerous functions, including axon guidance, morphogenesis, carcinogenesis, and immunomodulation. The encoded protein is a single-pass type I membrane protein containing an immunoglobulin-like C2-type domain, a PSI domain and a sema domain. It inhibits axonal extension by providing local signals to specify territories inaccessible for growing axons. It is an activator of T-cell-mediated immunity and suppresses vascular endothelial growth factor (VEGF)-mediated endothelial cell migration and proliferation in vitro and angiogenesis in vivo. Mutations in this gene are associated with retinal degenerative diseases including retinitis pigmentosa type 35 (RP35) and cone-rod dystrophy type 10 (CORD10). Multiple alternatively spliced transcript variants encoding different isoforms have been identified.[provided by RefSeq, Sep 2010]
PHENOTYPE: Homozygotes for a knock-out allele show no obvious brain defects but exhibit impaired T cell priming and defective Th1 responses. Homozygotes for a gene trap allele show severe retinal degeneration with reduced retinal vessels, depigmentation and dysfunction of both rod and cone photoreceptors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563I02Rik T C 14: 60,095,926 probably benign Het
4930579C12Rik A G 9: 89,168,207 noncoding transcript Het
Adam34 T A 8: 43,651,500 K369N probably benign Het
Ap1g1 T C 8: 109,851,065 W481R probably damaging Het
Bicdl1 G A 5: 115,731,292 P26S probably benign Het
Cacna1c A T 6: 118,630,270 C1224* probably null Het
Cpsf2 C T 12: 101,997,242 probably benign Het
Cyp11b2 G A 15: 74,853,641 R210W probably damaging Het
Dock7 C T 4: 98,989,258 V1048I probably benign Het
Dync2h1 C A 9: 7,077,979 A2908S probably benign Het
Elane A G 10: 79,887,108 D116G probably damaging Het
Epb41l2 C T 10: 25,507,816 R153C probably damaging Het
Gucy2c G A 6: 136,722,420 P617L probably damaging Het
Hist2h2ab G A 3: 96,220,123 A70T probably damaging Het
Kcnq4 T A 4: 120,746,861 I106L probably benign Het
Man2b1 A G 8: 85,096,829 N931D possibly damaging Het
Mthfs A G 9: 89,215,390 E100G probably damaging Het
Mto1 A T 9: 78,473,790 I639F probably damaging Het
Myo15 A G 11: 60,487,251 E177G probably damaging Het
Naip5 T A 13: 100,230,743 M282L probably benign Het
Olfr433 A G 1: 174,042,487 D179G probably damaging Het
Pik3c2g G A 6: 139,957,699 probably benign Het
Prl7d1 T A 13: 27,714,338 M64L probably benign Het
Prnp A T 2: 131,936,524 N32I probably damaging Het
Ptpn11 C T 5: 121,149,111 V406I probably benign Het
Rab40c G A 17: 25,884,693 T151I probably damaging Het
Rb1cc1 T A 1: 6,234,271 probably null Het
Rnf145 T C 11: 44,524,988 V10A probably benign Het
Rtn4rl2 T C 2: 84,880,692 N70S probably damaging Het
Scaper A T 9: 55,859,042 C483* probably null Het
Slf1 T C 13: 77,100,948 probably null Het
Sycp1 G T 3: 102,915,245 N364K probably benign Het
Tenm4 T C 7: 96,896,275 probably benign Het
Tnfaip2 A G 12: 111,450,707 T537A probably damaging Het
Trappc12 A G 12: 28,703,597 I573T possibly damaging Het
Ugt2b38 G A 5: 87,411,773 T420I probably damaging Het
Ulk1 A T 5: 110,789,545 probably benign Het
Unc80 G A 1: 66,648,944 C2367Y possibly damaging Het
Usp7 C A 16: 8,703,502 G135C probably damaging Het
Vmn2r103 A G 17: 19,793,927 Y327C probably damaging Het
Vmn2r28 T A 7: 5,488,027 H407L probably damaging Het
Zfp804a A C 2: 82,259,162 T1112P probably damaging Het
Zfr2 A G 10: 81,245,408 K431E probably damaging Het
Zfy1 A T Y: 725,850 Y638* probably null Het
Other mutations in Sema4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00913:Sema4a APN 3 88449810 missense probably damaging 1.00
IGL01722:Sema4a APN 3 88438184 missense probably benign 0.14
IGL01769:Sema4a APN 3 88449756 missense possibly damaging 0.86
IGL02076:Sema4a APN 3 88450522 missense probably damaging 0.99
IGL02202:Sema4a APN 3 88449743 missense probably damaging 1.00
R0145:Sema4a UTSW 3 88451422 missense probably damaging 1.00
R0386:Sema4a UTSW 3 88436800 missense possibly damaging 0.75
R0863:Sema4a UTSW 3 88448149 unclassified probably benign
R1567:Sema4a UTSW 3 88452046 missense probably damaging 1.00
R1675:Sema4a UTSW 3 88454766 missense possibly damaging 0.66
R1739:Sema4a UTSW 3 88436838 missense possibly damaging 0.94
R1801:Sema4a UTSW 3 88436749 missense probably benign 0.04
R1961:Sema4a UTSW 3 88438176 splice site probably benign
R2029:Sema4a UTSW 3 88451361 missense probably damaging 1.00
R4934:Sema4a UTSW 3 88438261 missense probably damaging 1.00
R5006:Sema4a UTSW 3 88436784 missense probably benign
R5309:Sema4a UTSW 3 88437036 missense probably damaging 1.00
R5312:Sema4a UTSW 3 88437036 missense probably damaging 1.00
R5338:Sema4a UTSW 3 88451497 missense probably benign 0.01
R5481:Sema4a UTSW 3 88453040 nonsense probably null
R5510:Sema4a UTSW 3 88449986 critical splice donor site probably null
R6046:Sema4a UTSW 3 88440701 missense probably damaging 1.00
R7242:Sema4a UTSW 3 88450109 missense probably damaging 1.00
R8403:Sema4a UTSW 3 88452034 missense probably damaging 0.98
R8798:Sema4a UTSW 3 88436697 missense possibly damaging 0.76
Z1176:Sema4a UTSW 3 88437193 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TGGCTGGGGTTACTGTAAGACCAC -3'
(R):5'- TGCCCTGCTGTTGAAGGATGAAG -3'

Sequencing Primer
(F):5'- CTGTCACTGCTGACTCAGAG -3'
(R):5'- CTGCTGTTGAAGGATGAAGGAAATG -3'
Posted On2013-10-16