Incidental Mutation 'R4198:Foxg1'
ID318646
Institutional Source Beutler Lab
Gene Symbol Foxg1
Ensembl Gene ENSMUSG00000020950
Gene Nameforkhead box G1
SynonymsHfh9, BF-1, 2900064B05Rik, Hfhbf1, Bf1
MMRRC Submission 041640-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4198 (G1)
Quality Score221
Status Not validated
Chromosome12
Chromosomal Location49382660-49386861 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 49385299 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 272 (S272T)
Ref Sequence ENSEMBL: ENSMUSP00000136372 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021333] [ENSMUST00000179669]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021333
AA Change: S272T

PolyPhen 2 Score 0.815 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000021333
Gene: ENSMUSG00000020950
AA Change: S272T

DomainStartEndE-ValueType
low complexity region 32 91 N/A INTRINSIC
low complexity region 107 134 N/A INTRINSIC
FH 171 261 6.85e-63 SMART
low complexity region 367 378 N/A INTRINSIC
low complexity region 417 442 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110746
AA Change: S42T

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000106374
Gene: ENSMUSG00000089922
AA Change: S42T

DomainStartEndE-ValueType
low complexity region 120 131 N/A INTRINSIC
low complexity region 169 198 N/A INTRINSIC
low complexity region 298 309 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127041
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135006
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154930
Predicted Effect possibly damaging
Transcript: ENSMUST00000179669
AA Change: S272T

PolyPhen 2 Score 0.815 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000136372
Gene: ENSMUSG00000020950
AA Change: S272T

DomainStartEndE-ValueType
low complexity region 32 91 N/A INTRINSIC
low complexity region 107 134 N/A INTRINSIC
FH 171 261 6.85e-63 SMART
low complexity region 367 378 N/A INTRINSIC
low complexity region 417 442 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218927
Meta Mutation Damage Score 0.1912 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a member of the forked-head transcription factor family. The encoded protein, which functions as a repressor, may play a role in brain development. Mutations at this locus have been associated with Rett syndrome. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous mutants exhibit dramatically reduced cerebral hemispheres, missing ventral telencephalic structures, impaired migration of efferent thalamocortical axons, and multiple eye defects. Mutants die at birth from respiratory failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aox1 G A 1: 58,085,607 M1002I probably benign Het
Ap2b1 C A 11: 83,342,603 Q481K probably damaging Het
Arhgap31 G A 16: 38,623,913 A194V probably damaging Het
Atp10a A G 7: 58,813,686 D989G probably damaging Het
Ccny G A 18: 9,332,928 T201I probably damaging Het
Cdca5 T C 19: 6,090,352 V181A possibly damaging Het
Ces1g A G 8: 93,305,868 I488T probably benign Het
Csmd2 A G 4: 128,510,924 T2368A probably benign Het
Cux1 T A 5: 136,286,848 I1113F probably damaging Het
Dnah3 C T 7: 119,922,838 G4033D probably damaging Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Fyco1 T C 9: 123,826,634 N1020D probably benign Het
Gprc5c T G 11: 114,863,860 L121R probably damaging Het
Hyou1 G A 9: 44,388,859 R815H probably damaging Het
Kera T C 10: 97,612,973 *352Q probably null Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lnpk T C 2: 74,569,109 E30G probably damaging Het
Map2 C T 1: 66,425,298 R128C probably damaging Het
Olfr1357 A T 10: 78,612,067 D191E possibly damaging Het
Olfr1381 G A 11: 49,552,634 V296M possibly damaging Het
Olfr573-ps1 A G 7: 102,941,797 F260S probably damaging Het
Olfr97 T A 17: 37,232,134 M79L probably benign Het
Ror2 A G 13: 53,110,644 M792T probably benign Het
Serpinb9d A G 13: 33,202,674 probably null Het
Serpinb9d A G 13: 33,202,965 I339V probably benign Het
Slc1a1 A G 19: 28,901,452 K197R probably benign Het
Snx20 A G 8: 88,627,598 V168A possibly damaging Het
Sowaha T C 11: 53,478,568 E447G possibly damaging Het
Stard8 AGAGGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGAGGA X: 99,066,508 probably benign Het
Stx19 G T 16: 62,822,676 C285F possibly damaging Het
Syp A G X: 7,639,927 probably null Het
Tbkbp1 C T 11: 97,149,068 probably null Het
Trim29 G T 9: 43,311,380 E169* probably null Het
Ttll12 T C 15: 83,577,013 N602D probably damaging Het
Zfp26 T C 9: 20,436,716 T851A probably benign Het
Zfp316 T C 5: 143,254,471 M598V probably benign Het
Zhx2 A G 15: 57,821,729 I165V probably benign Het
Other mutations in Foxg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01712:Foxg1 APN 12 49385620 missense possibly damaging 0.94
IGL02629:Foxg1 APN 12 49385548 missense probably benign 0.02
R0267:Foxg1 UTSW 12 49385582 missense probably damaging 1.00
R0486:Foxg1 UTSW 12 49384531 unclassified probably benign
R0646:Foxg1 UTSW 12 49384567 unclassified probably benign
R2110:Foxg1 UTSW 12 49384925 unclassified probably benign
R3784:Foxg1 UTSW 12 49385599 missense probably benign 0.04
R4199:Foxg1 UTSW 12 49385299 missense possibly damaging 0.81
R4200:Foxg1 UTSW 12 49385299 missense possibly damaging 0.81
R4360:Foxg1 UTSW 12 49384692 small deletion probably benign
R5044:Foxg1 UTSW 12 49385186 missense probably damaging 1.00
R6053:Foxg1 UTSW 12 49385378 missense possibly damaging 0.62
R6277:Foxg1 UTSW 12 49385516 missense probably benign 0.06
R6485:Foxg1 UTSW 12 49385080 missense probably damaging 1.00
R6979:Foxg1 UTSW 12 49384784 unclassified probably benign
R7033:Foxg1 UTSW 12 49384720 unclassified probably benign
R8156:Foxg1 UTSW 12 49384646 missense unknown
R8193:Foxg1 UTSW 12 49385594 missense possibly damaging 0.83
R8511:Foxg1 UTSW 12 49385085 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGAAGAACTTCCCCTACTACCG -3'
(R):5'- GAGTCAACACGGAGCTGTAG -3'

Sequencing Primer
(F):5'- TACTACCGCGAGAACAAGCAGG -3'
(R):5'- CACGGAGCTGTAGGGCATG -3'
Posted On2015-06-10