Incidental Mutation 'R4342:Pla2g4e'
ID 324158
Institutional Source Beutler Lab
Gene Symbol Pla2g4e
Ensembl Gene ENSMUSG00000050211
Gene Name phospholipase A2, group IVE
Synonyms Pla2epsilon, 2310026J01Rik
MMRRC Submission 041100-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R4342 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 120166412-120245335 bp(-) (GRCm38)
Type of Mutation intron
DNA Base Change (assembly) T to C at 120186446 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000087525 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090071]
AlphaFold Q50L42
Predicted Effect probably benign
Transcript: ENSMUST00000090071
SMART Domains Protein: ENSMUSP00000087525
Gene: ENSMUSG00000050211

DomainStartEndE-ValueType
low complexity region 61 73 N/A INTRINSIC
C2 82 182 3.42e-14 SMART
low complexity region 191 207 N/A INTRINSIC
PLAc 311 818 5.17e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127009
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136845
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152263
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytosolic phospholipase A2 group IV family. Members of this family are involved in regulation of membrane tubule-mediated transport. The enzyme encoded by this member of the family plays a role in trafficking through the clathrin-independent endocytic pathway. The enzyme regulates the recycling process via formation of tubules that transport internalized clathrin-independent cargo proteins back to the cell surface. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 T C 17: 45,516,495 C488R probably benign Het
Adamts19 A T 18: 58,942,500 H489L probably damaging Het
Ahnak T C 19: 9,012,083 V3577A possibly damaging Het
Arhgap44 G A 11: 65,012,061 R401* probably null Het
Cbx3-ps2 T C 13: 65,559,688 noncoding transcript Het
Ccdc174 T A 6: 91,885,356 L86* probably null Het
Cd38 A C 5: 43,869,089 I72L probably benign Het
Cers4 T C 8: 4,521,223 L264P probably damaging Het
Cldn23 A G 8: 35,825,498 S279P probably benign Het
Cth T A 3: 157,924,976 T19S probably damaging Het
Dnajc22 T A 15: 99,104,464 L330* probably null Het
Epas1 G A 17: 86,823,800 C336Y probably damaging Het
Evi5l A C 8: 4,183,492 probably benign Het
Fam71b A G 11: 46,407,216 D449G possibly damaging Het
Fbxl2 A T 9: 113,985,306 H272Q probably benign Het
Fgd3 C T 13: 49,273,709 probably null Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Fscn1 T C 5: 142,972,021 Y308H probably damaging Het
Gm5878 G A 6: 85,125,651 R31* probably null Het
Gm996 A G 2: 25,579,108 Y264H possibly damaging Het
Gpatch2l T C 12: 86,260,679 V277A probably benign Het
Greb1l T A 18: 10,544,561 M1385K probably benign Het
Grin2a A G 16: 9,653,589 I605T possibly damaging Het
Hoxc11 C T 15: 102,954,671 S49F probably damaging Het
Igf2r C T 17: 12,709,511 E982K possibly damaging Het
Ighv10-3 A T 12: 114,523,504 M99K possibly damaging Het
Itgb4 A T 11: 115,988,729 T614S probably benign Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Mast4 A G 13: 102,774,248 V461A probably damaging Het
Mcts2 G A 2: 152,687,664 V132M probably damaging Het
Mical3 C A 6: 120,934,838 E1083* probably null Het
Nbeal2 A G 9: 110,631,793 probably benign Het
Nek4 T C 14: 30,953,906 V66A probably damaging Het
Nfasc A G 1: 132,631,705 F229S probably damaging Het
Nhsl1 T C 10: 18,526,689 F1221S probably damaging Het
Nr1d1 T G 11: 98,771,814 K118Q probably damaging Het
Ntm T C 9: 29,109,431 E164G probably damaging Het
Olfr576 A G 7: 102,966,024 N308S probably benign Het
Parp1 G T 1: 180,587,329 A411S probably benign Het
Pds5b A G 5: 150,800,854 T1301A probably benign Het
Pkhd1 A G 1: 20,058,617 V3954A probably benign Het
Pkp4 A T 2: 59,350,608 K739I probably damaging Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Ralgds T C 2: 28,552,095 L96P probably damaging Het
Rbm6 A T 9: 107,847,247 probably benign Het
Scp2d1 T C 2: 144,824,167 L142P probably damaging Het
Setd5 AT ATT 6: 113,111,320 probably benign Het
Sgf29 G A 7: 126,671,777 C143Y probably damaging Het
Slc22a12 A G 19: 6,541,099 I156T probably benign Het
Stambpl1 A G 19: 34,234,046 Q169R probably benign Het
Tex2 T C 11: 106,567,006 probably benign Het
Trip11 A T 12: 101,884,316 I878N probably damaging Het
Ttf1 C T 2: 29,065,476 S284L probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ugt2b5 A T 5: 87,139,723 V195E probably damaging Het
Vmn1r14 T A 6: 57,233,823 Y85N probably benign Het
Wdyhv1 T C 15: 58,152,714 S120P probably benign Het
Zfp131 C T 13: 119,776,018 R268H probably damaging Het
Other mutations in Pla2g4e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00470:Pla2g4e APN 2 120185238 missense probably benign
IGL01712:Pla2g4e APN 2 120189403 critical splice donor site probably null
IGL01859:Pla2g4e APN 2 120182733 missense possibly damaging 0.70
IGL02334:Pla2g4e APN 2 120187236 missense probably benign
FR4737:Pla2g4e UTSW 2 120244724 small deletion probably benign
R0157:Pla2g4e UTSW 2 120170181 missense probably benign 0.00
R0578:Pla2g4e UTSW 2 120244681 splice site probably benign
R0675:Pla2g4e UTSW 2 120200198 splice site probably benign
R1278:Pla2g4e UTSW 2 120168470 critical splice donor site probably null
R1346:Pla2g4e UTSW 2 120182772 missense probably damaging 1.00
R1760:Pla2g4e UTSW 2 120170046 missense possibly damaging 0.50
R1773:Pla2g4e UTSW 2 120244721 missense probably benign
R1792:Pla2g4e UTSW 2 120168474 missense probably damaging 1.00
R2129:Pla2g4e UTSW 2 120182811 missense probably damaging 0.99
R2160:Pla2g4e UTSW 2 120185206 missense probably benign 0.00
R2191:Pla2g4e UTSW 2 120191199 frame shift probably null
R3901:Pla2g4e UTSW 2 120168604 missense probably benign 0.00
R4414:Pla2g4e UTSW 2 120182713 missense probably benign
R4460:Pla2g4e UTSW 2 120186382 missense possibly damaging 0.53
R4581:Pla2g4e UTSW 2 120186382 missense possibly damaging 0.53
R4599:Pla2g4e UTSW 2 120186382 missense possibly damaging 0.53
R4601:Pla2g4e UTSW 2 120186382 missense possibly damaging 0.53
R4610:Pla2g4e UTSW 2 120186382 missense possibly damaging 0.53
R4611:Pla2g4e UTSW 2 120186382 missense possibly damaging 0.53
R4664:Pla2g4e UTSW 2 120171188 missense probably damaging 0.97
R4688:Pla2g4e UTSW 2 120167933 missense possibly damaging 0.82
R4691:Pla2g4e UTSW 2 120174300 missense probably damaging 1.00
R4944:Pla2g4e UTSW 2 120171237 missense probably benign 0.01
R5051:Pla2g4e UTSW 2 120174304 missense probably damaging 1.00
R5285:Pla2g4e UTSW 2 120189504 missense probably damaging 1.00
R5373:Pla2g4e UTSW 2 120186395 missense probably benign 0.30
R5374:Pla2g4e UTSW 2 120186395 missense probably benign 0.30
R5505:Pla2g4e UTSW 2 120244775 missense probably benign 0.08
R5702:Pla2g4e UTSW 2 120188511 missense possibly damaging 0.61
R6300:Pla2g4e UTSW 2 120182738 missense probably benign 0.00
R6711:Pla2g4e UTSW 2 120171270 missense probably benign 0.00
R6920:Pla2g4e UTSW 2 120185314 missense possibly damaging 0.82
R6961:Pla2g4e UTSW 2 120174370 splice site probably null
R6987:Pla2g4e UTSW 2 120186380 missense probably benign 0.01
R7028:Pla2g4e UTSW 2 120170195 missense probably damaging 1.00
R7138:Pla2g4e UTSW 2 120171278 missense probably damaging 1.00
R7300:Pla2g4e UTSW 2 120191199 missense probably damaging 1.00
R7355:Pla2g4e UTSW 2 120181501 missense possibly damaging 0.91
R7502:Pla2g4e UTSW 2 120174338 splice site probably null
R7849:Pla2g4e UTSW 2 120185322 missense probably benign 0.32
R8288:Pla2g4e UTSW 2 120188509 critical splice donor site probably null
R8686:Pla2g4e UTSW 2 120244691 missense probably damaging 0.98
R9003:Pla2g4e UTSW 2 120176801 missense probably benign 0.03
R9023:Pla2g4e UTSW 2 120171237 missense probably benign 0.01
R9261:Pla2g4e UTSW 2 120189429 missense probably benign 0.04
R9299:Pla2g4e UTSW 2 120171723 missense probably damaging 1.00
R9338:Pla2g4e UTSW 2 120189433 missense probably benign 0.07
RF044:Pla2g4e UTSW 2 120244724 small deletion probably benign
Z1177:Pla2g4e UTSW 2 120181523 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CTGAGTTCCAAATTGACCTCGATC -3'
(R):5'- TCTCACTCACAAGGCTGAAC -3'

Sequencing Primer
(F):5'- TCCAAATTGACCTCGATCATCATAG -3'
(R):5'- ACTCCCAGTCAGCTGTGGTG -3'
Posted On 2015-06-24