Mutagenetix > Incidental Mutation

Incidental Mutation 'R4342:Pla2g4e'

324158

Institutional Source

Beutler Lab

Gene Symbol

Pla2g4e

Ensembl Gene

ENSMUSG00000050211

Gene Name

phospholipase A2, group IVE

Synonyms

Pla2epsilon, 2310026J01Rik

MMRRC Submission

041100-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4342 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

120166412-120245335 bp(-) (GRCm38)

Type of Mutation

intron

DNA Base Change (assembly)

T to C at 120186446 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000087525 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000090071]

AlphaFold

Q50L42

Predicted Effect

probably benign
Transcript: ENSMUST00000090071

SMART Domains

Protein: ENSMUSP00000087525
Gene: ENSMUSG00000050211

Domain	Start	End	E-Value	Type
low complexity region	61	73	N/A	INTRINSIC
C2	82	182	3.42e-14	SMART
low complexity region	191	207	N/A	INTRINSIC
PLAc	311	818	5.17e-13	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127009

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136845

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152263

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.4%

Validation Efficiency

99% (68/69)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytosolic phospholipase A2 group IV family. Members of this family are involved in regulation of membrane tubule-mediated transport. The enzyme encoded by this member of the family plays a role in trafficking through the clathrin-independent endocytic pathway. The enzyme regulates the recycling process via formation of tubules that transport internalized clathrin-independent cargo proteins back to the cell surface. [provided by RefSeq, Jan 2017]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aars2	T	C	17: 45,516,495	C488R	probably benign	Het
Adamts19	A	T	18: 58,942,500	H489L	probably damaging	Het
Ahnak	T	C	19: 9,012,083	V3577A	possibly damaging	Het
Arhgap44	G	A	11: 65,012,061	R401*	probably null	Het
Cbx3-ps2	T	C	13: 65,559,688		noncoding transcript	Het
Ccdc174	T	A	6: 91,885,356	L86*	probably null	Het
Cd38	A	C	5: 43,869,089	I72L	probably benign	Het
Cers4	T	C	8: 4,521,223	L264P	probably damaging	Het
Cldn23	A	G	8: 35,825,498	S279P	probably benign	Het
Cth	T	A	3: 157,924,976	T19S	probably damaging	Het
Dnajc22	T	A	15: 99,104,464	L330*	probably null	Het
Epas1	G	A	17: 86,823,800	C336Y	probably damaging	Het
Evi5l	A	C	8: 4,183,492		probably benign	Het
Fam71b	A	G	11: 46,407,216	D449G	possibly damaging	Het
Fbxl2	A	T	9: 113,985,306	H272Q	probably benign	Het
Fgd3	C	T	13: 49,273,709		probably null	Het
Fhdc1	C	A	3: 84,444,826	V1031F	probably benign	Het
Fscn1	T	C	5: 142,972,021	Y308H	probably damaging	Het
Gm5878	G	A	6: 85,125,651	R31*	probably null	Het
Gm996	A	G	2: 25,579,108	Y264H	possibly damaging	Het
Gpatch2l	T	C	12: 86,260,679	V277A	probably benign	Het
Greb1l	T	A	18: 10,544,561	M1385K	probably benign	Het
Grin2a	A	G	16: 9,653,589	I605T	possibly damaging	Het
Hoxc11	C	T	15: 102,954,671	S49F	probably damaging	Het
Igf2r	C	T	17: 12,709,511	E982K	possibly damaging	Het
Ighv10-3	A	T	12: 114,523,504	M99K	possibly damaging	Het
Itgb4	A	T	11: 115,988,729	T614S	probably benign	Het
Kcnv1	G	A	15: 45,114,444	T66M	probably damaging	Het
Mast4	A	G	13: 102,774,248	V461A	probably damaging	Het
Mcts2	G	A	2: 152,687,664	V132M	probably damaging	Het
Mical3	C	A	6: 120,934,838	E1083*	probably null	Het
Nbeal2	A	G	9: 110,631,793		probably benign	Het
Nek4	T	C	14: 30,953,906	V66A	probably damaging	Het
Nfasc	A	G	1: 132,631,705	F229S	probably damaging	Het
Nhsl1	T	C	10: 18,526,689	F1221S	probably damaging	Het
Nr1d1	T	G	11: 98,771,814	K118Q	probably damaging	Het
Ntm	T	C	9: 29,109,431	E164G	probably damaging	Het
Olfr576	A	G	7: 102,966,024	N308S	probably benign	Het
Parp1	G	T	1: 180,587,329	A411S	probably benign	Het
Pds5b	A	G	5: 150,800,854	T1301A	probably benign	Het
Pkhd1	A	G	1: 20,058,617	V3954A	probably benign	Het
Pkp4	A	T	2: 59,350,608	K739I	probably damaging	Het
Plod3	G	C	5: 136,988,146	A50P	probably benign	Het
Ralgds	T	C	2: 28,552,095	L96P	probably damaging	Het
Rbm6	A	T	9: 107,847,247		probably benign	Het
Scp2d1	T	C	2: 144,824,167	L142P	probably damaging	Het
Setd5	AT	ATT	6: 113,111,320		probably benign	Het
Sgf29	G	A	7: 126,671,777	C143Y	probably damaging	Het
Slc22a12	A	G	19: 6,541,099	I156T	probably benign	Het
Stambpl1	A	G	19: 34,234,046	Q169R	probably benign	Het
Tex2	T	C	11: 106,567,006		probably benign	Het
Trip11	A	T	12: 101,884,316	I878N	probably damaging	Het
Ttf1	C	T	2: 29,065,476	S284L	probably benign	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Ugt2b5	A	T	5: 87,139,723	V195E	probably damaging	Het
Vmn1r14	T	A	6: 57,233,823	Y85N	probably benign	Het
Wdyhv1	T	C	15: 58,152,714	S120P	probably benign	Het
Zfp131	C	T	13: 119,776,018	R268H	probably damaging	Het

Other mutations in Pla2g4e

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00470:Pla2g4e	APN	2	120185238	missense	probably benign
IGL01712:Pla2g4e	APN	2	120189403	critical splice donor site	probably null
IGL01859:Pla2g4e	APN	2	120182733	missense	possibly damaging	0.70
IGL02334:Pla2g4e	APN	2	120187236	missense	probably benign
FR4737:Pla2g4e	UTSW	2	120244724	small deletion	probably benign
R0157:Pla2g4e	UTSW	2	120170181	missense	probably benign	0.00
R0578:Pla2g4e	UTSW	2	120244681	splice site	probably benign
R0675:Pla2g4e	UTSW	2	120200198	splice site	probably benign
R1278:Pla2g4e	UTSW	2	120168470	critical splice donor site	probably null
R1346:Pla2g4e	UTSW	2	120182772	missense	probably damaging	1.00
R1760:Pla2g4e	UTSW	2	120170046	missense	possibly damaging	0.50
R1773:Pla2g4e	UTSW	2	120244721	missense	probably benign
R1792:Pla2g4e	UTSW	2	120168474	missense	probably damaging	1.00
R2129:Pla2g4e	UTSW	2	120182811	missense	probably damaging	0.99
R2160:Pla2g4e	UTSW	2	120185206	missense	probably benign	0.00
R2191:Pla2g4e	UTSW	2	120191199	frame shift	probably null
R3901:Pla2g4e	UTSW	2	120168604	missense	probably benign	0.00
R4414:Pla2g4e	UTSW	2	120182713	missense	probably benign
R4460:Pla2g4e	UTSW	2	120186382	missense	possibly damaging	0.53
R4581:Pla2g4e	UTSW	2	120186382	missense	possibly damaging	0.53
R4599:Pla2g4e	UTSW	2	120186382	missense	possibly damaging	0.53
R4601:Pla2g4e	UTSW	2	120186382	missense	possibly damaging	0.53
R4610:Pla2g4e	UTSW	2	120186382	missense	possibly damaging	0.53
R4611:Pla2g4e	UTSW	2	120186382	missense	possibly damaging	0.53
R4664:Pla2g4e	UTSW	2	120171188	missense	probably damaging	0.97
R4688:Pla2g4e	UTSW	2	120167933	missense	possibly damaging	0.82
R4691:Pla2g4e	UTSW	2	120174300	missense	probably damaging	1.00
R4944:Pla2g4e	UTSW	2	120171237	missense	probably benign	0.01
R5051:Pla2g4e	UTSW	2	120174304	missense	probably damaging	1.00
R5285:Pla2g4e	UTSW	2	120189504	missense	probably damaging	1.00
R5373:Pla2g4e	UTSW	2	120186395	missense	probably benign	0.30
R5374:Pla2g4e	UTSW	2	120186395	missense	probably benign	0.30
R5505:Pla2g4e	UTSW	2	120244775	missense	probably benign	0.08
R5702:Pla2g4e	UTSW	2	120188511	missense	possibly damaging	0.61
R6300:Pla2g4e	UTSW	2	120182738	missense	probably benign	0.00
R6711:Pla2g4e	UTSW	2	120171270	missense	probably benign	0.00
R6920:Pla2g4e	UTSW	2	120185314	missense	possibly damaging	0.82
R6961:Pla2g4e	UTSW	2	120174370	splice site	probably null
R6987:Pla2g4e	UTSW	2	120186380	missense	probably benign	0.01
R7028:Pla2g4e	UTSW	2	120170195	missense	probably damaging	1.00
R7138:Pla2g4e	UTSW	2	120171278	missense	probably damaging	1.00
R7300:Pla2g4e	UTSW	2	120191199	missense	probably damaging	1.00
R7355:Pla2g4e	UTSW	2	120181501	missense	possibly damaging	0.91
R7502:Pla2g4e	UTSW	2	120174338	splice site	probably null
R7849:Pla2g4e	UTSW	2	120185322	missense	probably benign	0.32
R8288:Pla2g4e	UTSW	2	120188509	critical splice donor site	probably null
R8686:Pla2g4e	UTSW	2	120244691	missense	probably damaging	0.98
R9003:Pla2g4e	UTSW	2	120176801	missense	probably benign	0.03
R9023:Pla2g4e	UTSW	2	120171237	missense	probably benign	0.01
R9261:Pla2g4e	UTSW	2	120189429	missense	probably benign	0.04
R9284:Pla2g4e	UTSW	2	120174249	splice site	probably benign
R9299:Pla2g4e	UTSW	2	120171723	missense	probably damaging	1.00
R9338:Pla2g4e	UTSW	2	120189433	missense	probably benign	0.07
R9555:Pla2g4e	UTSW	2	120244919	start gained	probably benign
R9604:Pla2g4e	UTSW	2	120185199	missense	probably benign	0.02
RF044:Pla2g4e	UTSW	2	120244724	small deletion	probably benign
Z1177:Pla2g4e	UTSW	2	120181523	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- CTGAGTTCCAAATTGACCTCGATC -3'
(R):5'- TCTCACTCACAAGGCTGAAC -3'

Sequencing Primer
(F):5'- TCCAAATTGACCTCGATCATCATAG -3'
(R):5'- ACTCCCAGTCAGCTGTGGTG -3'

Posted On

2015-06-24