Incidental Mutation 'R4342:Cldn23'
ID324178
Institutional Source Beutler Lab
Gene Symbol Cldn23
Ensembl Gene ENSMUSG00000055976
Gene Nameclaudin 23
Synonyms
MMRRC Submission 041100-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R4342 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location35824712-35826559 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 35825498 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 279 (S279P)
Ref Sequence ENSEMBL: ENSMUSP00000049725 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060128]
Predicted Effect probably benign
Transcript: ENSMUST00000060128
AA Change: S279P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000049725
Gene: ENSMUSG00000055976
AA Change: S279P

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 3 177 6e-19 PFAM
low complexity region 273 284 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000210370
Meta Mutation Damage Score 0.0690 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: This gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions. This gene is intronless and the protein encoded by this gene is 77% identical to the human homolog. [provided by RefSeq, Aug 2010]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 T C 17: 45,516,495 C488R probably benign Het
Adamts19 A T 18: 58,942,500 H489L probably damaging Het
Ahnak T C 19: 9,012,083 V3577A possibly damaging Het
Arhgap44 G A 11: 65,012,061 R401* probably null Het
Cbx3-ps2 T C 13: 65,559,688 noncoding transcript Het
Ccdc174 T A 6: 91,885,356 L86* probably null Het
Cd38 A C 5: 43,869,089 I72L probably benign Het
Cers4 T C 8: 4,521,223 L264P probably damaging Het
Cth T A 3: 157,924,976 T19S probably damaging Het
Dnajc22 T A 15: 99,104,464 L330* probably null Het
Epas1 G A 17: 86,823,800 C336Y probably damaging Het
Evi5l A C 8: 4,183,492 probably benign Het
Fam71b A G 11: 46,407,216 D449G possibly damaging Het
Fbxl2 A T 9: 113,985,306 H272Q probably benign Het
Fgd3 C T 13: 49,273,709 probably null Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Fscn1 T C 5: 142,972,021 Y308H probably damaging Het
Gm5878 G A 6: 85,125,651 R31* probably null Het
Gm996 A G 2: 25,579,108 Y264H possibly damaging Het
Gpatch2l T C 12: 86,260,679 V277A probably benign Het
Greb1l T A 18: 10,544,561 M1385K probably benign Het
Grin2a A G 16: 9,653,589 I605T possibly damaging Het
Hoxc11 C T 15: 102,954,671 S49F probably damaging Het
Igf2r C T 17: 12,709,511 E982K possibly damaging Het
Ighv10-3 A T 12: 114,523,504 M99K possibly damaging Het
Itgb4 A T 11: 115,988,729 T614S probably benign Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Mast4 A G 13: 102,774,248 V461A probably damaging Het
Mcts2 G A 2: 152,687,664 V132M probably damaging Het
Mical3 C A 6: 120,934,838 E1083* probably null Het
Nbeal2 A G 9: 110,631,793 probably benign Het
Nek4 T C 14: 30,953,906 V66A probably damaging Het
Nfasc A G 1: 132,631,705 F229S probably damaging Het
Nhsl1 T C 10: 18,526,689 F1221S probably damaging Het
Nr1d1 T G 11: 98,771,814 K118Q probably damaging Het
Ntm T C 9: 29,109,431 E164G probably damaging Het
Olfr576 A G 7: 102,966,024 N308S probably benign Het
Parp1 G T 1: 180,587,329 A411S probably benign Het
Pds5b A G 5: 150,800,854 T1301A probably benign Het
Pkhd1 A G 1: 20,058,617 V3954A probably benign Het
Pkp4 A T 2: 59,350,608 K739I probably damaging Het
Pla2g4e T C 2: 120,186,446 probably benign Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Ralgds T C 2: 28,552,095 L96P probably damaging Het
Rbm6 A T 9: 107,847,247 probably benign Het
Scp2d1 T C 2: 144,824,167 L142P probably damaging Het
Setd5 AT ATT 6: 113,111,320 probably benign Het
Sgf29 G A 7: 126,671,777 C143Y probably damaging Het
Slc22a12 A G 19: 6,541,099 I156T probably benign Het
Stambpl1 A G 19: 34,234,046 Q169R probably benign Het
Tex2 T C 11: 106,567,006 probably benign Het
Trip11 A T 12: 101,884,316 I878N probably damaging Het
Ttf1 C T 2: 29,065,476 S284L probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ugt2b5 A T 5: 87,139,723 V195E probably damaging Het
Vmn1r14 T A 6: 57,233,823 Y85N probably benign Het
Wdyhv1 T C 15: 58,152,714 S120P probably benign Het
Zfp131 C T 13: 119,776,018 R268H probably damaging Het
Other mutations in Cldn23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01667:Cldn23 APN 8 35825920 missense possibly damaging 0.81
IGL01767:Cldn23 APN 8 35825662 missense probably damaging 1.00
IGL02078:Cldn23 APN 8 35826205 missense possibly damaging 0.94
IGL03346:Cldn23 APN 8 35825440 intron probably benign
R1610:Cldn23 UTSW 8 35825930 missense probably damaging 1.00
R1753:Cldn23 UTSW 8 35825986 missense possibly damaging 0.94
R1915:Cldn23 UTSW 8 35825945 missense possibly damaging 0.69
R2121:Cldn23 UTSW 8 35826235 missense probably benign
R5167:Cldn23 UTSW 8 35826320 missense possibly damaging 0.89
R5207:Cldn23 UTSW 8 35826028 missense probably damaging 1.00
R6102:Cldn23 UTSW 8 35825551 missense probably benign 0.00
R7106:Cldn23 UTSW 8 35825915 missense probably benign
R7363:Cldn23 UTSW 8 35825505 critical splice donor site probably null
R7721:Cldn23 UTSW 8 35826263 missense possibly damaging 0.89
R8119:Cldn23 UTSW 8 35825902 missense probably damaging 0.99
Z1176:Cldn23 UTSW 8 35826277 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGGTCCCTCTGGAGAGAAAAG -3'
(R):5'- AGTACTACAGCGACGGACAG -3'

Sequencing Primer
(F):5'- CCCAACCTAGTATTTGGAGAGG -3'
(R):5'- TACAGCGACGGACAGCATCG -3'
Posted On2015-06-24