Incidental Mutation 'R4373:Lrtm2'
ID326061
Institutional Source Beutler Lab
Gene Symbol Lrtm2
Ensembl Gene ENSMUSG00000055003
Gene Nameleucine-rich repeats and transmembrane domains 2
Synonyms
MMRRC Submission 041675-MU
Accession Numbers

Genbank: NM_172492.3, NM_001172207.1; Ensembl: ENSMUST00000068351

Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R4373 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location119315133-119330766 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 119320528 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 184 (F184S)
Ref Sequence ENSEMBL: ENSMUSP00000126661 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037434] [ENSMUST00000068351] [ENSMUST00000112756] [ENSMUST00000124192] [ENSMUST00000168793] [ENSMUST00000186622]
Predicted Effect probably benign
Transcript: ENSMUST00000037434
SMART Domains Protein: ENSMUSP00000044660
Gene: ENSMUSG00000041460

DomainStartEndE-ValueType
Blast:WNT1 79 144 1e-13 BLAST
Pfam:VWA_N 155 271 7.3e-40 PFAM
VWA 296 481 4.37e-14 SMART
Pfam:Cache_1 494 586 1.1e-24 PFAM
low complexity region 837 849 N/A INTRINSIC
low complexity region 975 984 N/A INTRINSIC
low complexity region 1000 1011 N/A INTRINSIC
low complexity region 1120 1143 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000068351
AA Change: F184S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000063882
Gene: ENSMUSG00000055003
AA Change: F184S

DomainStartEndE-ValueType
LRRNT 38 72 5.22e-8 SMART
LRR 71 90 1.58e2 SMART
LRR_TYP 91 114 2.43e-4 SMART
LRR_TYP 115 138 7.78e-3 SMART
LRR 140 162 5.72e-1 SMART
LRR 163 186 3.78e-1 SMART
LRRCT 198 251 3.1e-7 SMART
low complexity region 271 290 N/A INTRINSIC
transmembrane domain 312 334 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112756
AA Change: F184S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108376
Gene: ENSMUSG00000055003
AA Change: F184S

DomainStartEndE-ValueType
LRRNT 38 72 5.22e-8 SMART
LRR 71 90 1.58e2 SMART
LRR_TYP 91 114 2.43e-4 SMART
LRR_TYP 115 138 7.78e-3 SMART
LRR 140 162 5.72e-1 SMART
LRR 163 186 3.78e-1 SMART
LRRCT 198 251 3.1e-7 SMART
low complexity region 271 290 N/A INTRINSIC
transmembrane domain 312 334 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124192
Predicted Effect probably damaging
Transcript: ENSMUST00000168793
AA Change: F184S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126661
Gene: ENSMUSG00000055003
AA Change: F184S

DomainStartEndE-ValueType
LRRNT 38 72 5.22e-8 SMART
LRR 71 90 1.58e2 SMART
LRR_TYP 91 114 2.43e-4 SMART
LRR_TYP 115 138 7.78e-3 SMART
LRR 140 162 5.72e-1 SMART
LRR 163 186 3.78e-1 SMART
LRRCT 198 251 3.1e-7 SMART
low complexity region 271 290 N/A INTRINSIC
transmembrane domain 312 334 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186622
SMART Domains Protein: ENSMUSP00000140197
Gene: ENSMUSG00000041460

DomainStartEndE-ValueType
Blast:WNT1 79 144 1e-13 BLAST
Pfam:VWA_N 155 271 6.4e-44 PFAM
VWA 296 481 2.7e-16 SMART
Pfam:Cache_1 494 559 1.1e-7 PFAM
low complexity region 812 824 N/A INTRINSIC
low complexity region 950 959 N/A INTRINSIC
low complexity region 975 986 N/A INTRINSIC
low complexity region 1095 1118 N/A INTRINSIC
Meta Mutation Damage Score 0.7747 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 98% (54/55)
Allele List at MGI

All alleles(5) : Targeted, other(2) Gene trapped(3)

Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A T 11: 23,615,265 probably null Het
3632451O06Rik T A 14: 49,770,436 T527S probably damaging Het
Adck5 A G 15: 76,594,335 probably benign Het
Akr1b3 A C 6: 34,304,267 probably benign Het
Asns A T 6: 7,677,978 S367T probably damaging Het
BC034090 T C 1: 155,226,158 N120S probably benign Het
Bub1 A T 2: 127,805,236 probably benign Het
Csf1 T A 3: 107,756,739 T38S probably damaging Het
Ctsz T C 2: 174,428,585 E268G possibly damaging Het
Dach1 G A 14: 97,827,750 T685I possibly damaging Het
Dclre1a A G 19: 56,545,442 L240S probably benign Het
Ercc1 G A 7: 19,347,132 probably benign Het
Esam C T 9: 37,534,196 T71I probably benign Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Gde1 A G 7: 118,698,558 L35P possibly damaging Het
Gm10382 A G 5: 125,389,583 probably benign Het
H2-M10.6 T C 17: 36,813,066 Y141H probably damaging Het
Hk1 C A 10: 62,315,540 K10N probably damaging Het
Lamc3 A G 2: 31,898,232 K135E probably damaging Het
March11 A G 15: 26,309,446 E62G probably damaging Het
Mtcl1 T A 17: 66,380,079 T611S probably benign Het
Myc A T 15: 61,989,664 H373L probably damaging Het
Myh6 T A 14: 54,962,108 I249F probably damaging Het
Naaa T C 5: 92,278,143 probably benign Het
Nfib A G 4: 82,323,658 V432A probably damaging Het
Nmt1 A G 11: 103,043,200 K55R probably damaging Het
Olfr1228 T C 2: 89,249,245 R150G possibly damaging Het
Opa3 C T 7: 19,244,774 R55W probably damaging Het
Pfn4 T A 12: 4,770,182 D10E probably damaging Het
Pld5 T A 1: 176,140,017 I91F probably damaging Het
Plec A C 15: 76,183,117 S1350A probably damaging Het
Polq G T 16: 37,013,181 V79F probably damaging Het
Ppp1r16b T C 2: 158,761,765 Y537H probably damaging Het
Prdm8 T C 5: 98,186,508 S645P probably damaging Het
Rgs1 T C 1: 144,247,906 T94A probably benign Het
Rpl11 G A 4: 136,051,143 probably benign Het
Scamp3 G A 3: 89,181,927 probably null Het
Sgsm1 TTTTATATT TTT 5: 113,258,123 probably benign Het
Sirpb1b A T 3: 15,548,761 I87K probably damaging Het
Slc14a2 G A 18: 78,207,068 R62C probably damaging Het
Stat4 T C 1: 52,071,941 probably null Het
Tex9 A T 9: 72,480,595 probably null Het
Tsku T C 7: 98,352,831 T98A probably benign Het
Ttc23l CT CTTGGATT 15: 10,537,562 probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Vmn2r116 A C 17: 23,401,421 I710L probably benign Het
Vmn2r16 A T 5: 109,363,801 I625F probably damaging Het
Xpo4 G A 14: 57,591,022 Q794* probably null Het
Zfp112 T A 7: 24,125,048 I147N probably damaging Het
Zmiz1 T C 14: 25,636,010 S140P probably damaging Het
Other mutations in Lrtm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01089:Lrtm2 APN 6 119320792 missense possibly damaging 0.91
IGL02619:Lrtm2 APN 6 119317238 missense probably damaging 1.00
IGL02694:Lrtm2 APN 6 119320885 missense possibly damaging 0.80
1mM(1):Lrtm2 UTSW 6 119317291 missense probably damaging 0.99
R0458:Lrtm2 UTSW 6 119317268 missense probably damaging 1.00
R1183:Lrtm2 UTSW 6 119320885 missense probably benign 0.02
R1502:Lrtm2 UTSW 6 119317274 missense probably benign 0.02
R3801:Lrtm2 UTSW 6 119317483 missense probably damaging 1.00
R5126:Lrtm2 UTSW 6 119317439 missense probably benign 0.04
R6366:Lrtm2 UTSW 6 119317277 missense probably damaging 0.99
R7177:Lrtm2 UTSW 6 119317152 missense probably damaging 0.99
R7442:Lrtm2 UTSW 6 119317431 missense probably damaging 0.99
R7448:Lrtm2 UTSW 6 119320823 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTCCTCTGACTGCAGGAATTG -3'
(R):5'- CAGCTTCGGAATAACAGCATCAG -3'

Sequencing Primer
(F):5'- CTCTGACTGCAGGAATTGGTGATG -3'
(R):5'- TAACAGCATCAGGACCCTGG -3'
Posted On2015-07-06