Incidental Mutation 'R4417:Mtmr11'
ID326870
Institutional Source Beutler Lab
Gene Symbol Mtmr11
Ensembl Gene ENSMUSG00000045934
Gene Namemyotubularin related protein 11
Synonyms
MMRRC Submission 041138-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.171) question?
Stock #R4417 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location96162004-96171718 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 96167891 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000118258 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054356] [ENSMUST00000076372] [ENSMUST00000129925]
Predicted Effect probably benign
Transcript: ENSMUST00000054356
SMART Domains Protein: ENSMUSP00000062341
Gene: ENSMUSG00000045934

DomainStartEndE-ValueType
Pfam:Myotub-related 191 323 1.7e-12 PFAM
Pfam:Myotub-related 312 488 1.3e-44 PFAM
Pfam:3-PAP 550 683 2.3e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000076372
SMART Domains Protein: ENSMUSP00000075709
Gene: ENSMUSG00000068856

DomainStartEndE-ValueType
RRM 14 87 1.46e-25 SMART
RRM 101 175 5.07e-25 SMART
low complexity region 214 307 N/A INTRINSIC
low complexity region 310 423 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123520
Predicted Effect probably benign
Transcript: ENSMUST00000129925
SMART Domains Protein: ENSMUSP00000118258
Gene: ENSMUSG00000045934

DomainStartEndE-ValueType
Pfam:Myotub-related 162 264 4.2e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147245
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152763
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153977
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154955
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180958
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196004
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199721
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 100% (53/53)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik T C 4: 41,505,574 T183A possibly damaging Het
A630001G21Rik T A 1: 85,726,463 Y51F probably damaging Het
Abi3bp C A 16: 56,654,035 T631K probably damaging Het
BC004004 G A 17: 29,282,275 probably benign Het
Cabp1 G A 5: 115,186,037 S7L possibly damaging Het
Cdc23 ACC AC 18: 34,637,318 probably null Het
Clhc1 T C 11: 29,571,826 I453T possibly damaging Het
Col28a1 T A 6: 8,175,666 I61F possibly damaging Het
Col2a1 T C 15: 97,998,585 E61G unknown Het
Col6a4 C T 9: 106,072,016 V807I probably damaging Het
Crhbp T C 13: 95,443,877 S65G probably benign Het
Dnah9 T A 11: 65,981,214 Q2730L possibly damaging Het
Epx T A 11: 87,869,430 R453* probably null Het
Fez1 T C 9: 36,870,472 probably benign Het
G530012D18Rik G C 1: 85,577,202 probably benign Het
Glp2r T C 11: 67,664,516 probably benign Het
Gm1141 G A X: 71,939,619 C399Y possibly damaging Het
Gpm6a T A 8: 55,050,188 N157K probably damaging Het
Kcnj2 T C 11: 111,072,189 S136P probably damaging Het
Lad1 A G 1: 135,828,746 D364G probably benign Het
Lcp2 G T 11: 34,050,917 E33D probably benign Het
Lrrc32 G T 7: 98,498,937 R308L probably benign Het
Matr3 C A 18: 35,572,118 A32D probably damaging Het
Mfsd12 A G 10: 81,364,703 probably benign Het
Notch2 A G 3: 98,131,270 D1243G possibly damaging Het
Odf2 T A 2: 29,915,321 probably benign Het
Oit3 T C 10: 59,428,103 Y403C probably damaging Het
Olfr1233 T C 2: 89,339,987 E105G probably benign Het
Pitpnm2 G T 5: 124,123,569 R977S probably damaging Het
Prdm13 T C 4: 21,678,756 E578G probably benign Het
Pum3 A G 19: 27,422,716 I183T probably damaging Het
Rdh14 G A 12: 10,391,231 probably null Het
Slc35b2 G A 17: 45,566,429 V161M probably benign Het
Slit1 A G 19: 41,614,469 C968R probably damaging Het
Spag9 A T 11: 94,060,346 probably benign Het
Stox1 T C 10: 62,659,569 N975S probably benign Het
Stradb T C 1: 58,994,372 V398A probably benign Het
Tlr4 A T 4: 66,839,303 N111I probably damaging Het
Tnip2 G A 5: 34,503,581 R176* probably null Het
Tomm7 A G 5: 23,843,979 I32T probably benign Het
Trank1 T C 9: 111,365,968 I1020T probably benign Het
Ugt1a10 T G 1: 88,055,995 S172A probably benign Het
Vmn2r115 T A 17: 23,345,880 M247K probably benign Het
Zfp341 T C 2: 154,628,987 L308P possibly damaging Het
Zmym6 T C 4: 127,092,988 S154P probably damaging Het
Other mutations in Mtmr11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02539:Mtmr11 APN 3 96164991 intron probably benign
R1017:Mtmr11 UTSW 3 96164477 missense probably damaging 1.00
R1589:Mtmr11 UTSW 3 96168113 missense probably benign 0.16
R1836:Mtmr11 UTSW 3 96164786 missense probably damaging 0.98
R2264:Mtmr11 UTSW 3 96169097 missense possibly damaging 0.53
R3623:Mtmr11 UTSW 3 96165266 missense probably damaging 1.00
R4195:Mtmr11 UTSW 3 96167891 splice site probably benign
R4243:Mtmr11 UTSW 3 96168077 missense probably damaging 1.00
R4245:Mtmr11 UTSW 3 96168077 missense probably damaging 1.00
R4414:Mtmr11 UTSW 3 96167891 splice site probably benign
R4461:Mtmr11 UTSW 3 96167891 splice site probably benign
R4468:Mtmr11 UTSW 3 96167891 splice site probably benign
R4963:Mtmr11 UTSW 3 96163250 intron probably benign
R5134:Mtmr11 UTSW 3 96169907 missense probably damaging 1.00
R5154:Mtmr11 UTSW 3 96164319 missense probably benign 0.03
R5508:Mtmr11 UTSW 3 96163767 missense probably damaging 1.00
R5821:Mtmr11 UTSW 3 96167869 missense possibly damaging 0.91
R5868:Mtmr11 UTSW 3 96171202 missense possibly damaging 0.65
R5991:Mtmr11 UTSW 3 96168589 unclassified probably null
R6084:Mtmr11 UTSW 3 96168084 missense probably damaging 0.99
R6354:Mtmr11 UTSW 3 96168676 missense probably benign 0.07
R6446:Mtmr11 UTSW 3 96171188 missense probably benign 0.00
R6821:Mtmr11 UTSW 3 96170407 missense probably benign
R7033:Mtmr11 UTSW 3 96169946 missense probably damaging 1.00
R7312:Mtmr11 UTSW 3 96164538 missense possibly damaging 0.68
R7878:Mtmr11 UTSW 3 96169199 missense probably benign 0.00
R7899:Mtmr11 UTSW 3 96170428 missense probably damaging 1.00
R7961:Mtmr11 UTSW 3 96169199 missense probably benign 0.00
R7982:Mtmr11 UTSW 3 96170428 missense probably damaging 1.00
X0019:Mtmr11 UTSW 3 96164492 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACCAGACTTCTTATCCCATCTG -3'
(R):5'- CTGGAAGGGCGTGTGATGAA -3'

Sequencing Primer
(F):5'- CATAGTCAGCTGCTGTGGACAATC -3'
(R):5'- TGATGAAGAAGGGAGTAATGTATTGG -3'
Posted On2015-07-07