Incidental Mutation 'R4426:Sptbn4'
ID328162
Institutional Source Beutler Lab
Gene Symbol Sptbn4
Ensembl Gene ENSMUSG00000011751
Gene Namespectrin beta, non-erythrocytic 4
SynonymsROSA62, 1700022P15Rik, dyn, neuroaxonal dystrophy, 5830426A08Rik, nmf261, SpbIV, Spnb4
MMRRC Submission 041697-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.656) question?
Stock #R4426 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location27356383-27447686 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 27423798 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 233 (L233R)
Ref Sequence ENSEMBL: ENSMUSP00000132807 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000011895] [ENSMUST00000172269]
Predicted Effect probably damaging
Transcript: ENSMUST00000011895
AA Change: L233R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000011895
Gene: ENSMUSG00000011751
AA Change: L233R

DomainStartEndE-ValueType
low complexity region 39 45 N/A INTRINSIC
CH 64 164 8.03e-24 SMART
CH 183 281 7.38e-23 SMART
Pfam:Spectrin 310 420 1.4e-10 PFAM
SPEC 433 533 5.22e-26 SMART
SPEC 539 642 7.62e-19 SMART
SPEC 648 766 1.31e-8 SMART
SPEC 772 874 2.94e-11 SMART
SPEC 880 980 1.49e-21 SMART
SPEC 986 1081 1.65e0 SMART
SPEC 1087 1192 2.82e-13 SMART
SPEC 1198 1298 6.59e-14 SMART
SPEC 1304 1403 4.08e-19 SMART
SPEC 1409 1508 5.92e-7 SMART
SPEC 1514 1614 2.45e-22 SMART
SPEC 1620 1720 1.45e-24 SMART
SPEC 1726 1827 1.86e-22 SMART
SPEC 1833 1935 9.54e-11 SMART
SPEC 1941 2041 1.35e-19 SMART
SPEC 2047 2297 1.06e-8 SMART
low complexity region 2358 2412 N/A INTRINSIC
PH 2416 2526 1.54e-14 SMART
low complexity region 2549 2560 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000172269
AA Change: L233R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132807
Gene: ENSMUSG00000011751
AA Change: L233R

DomainStartEndE-ValueType
low complexity region 39 45 N/A INTRINSIC
CH 64 164 8.03e-24 SMART
CH 183 281 7.38e-23 SMART
Pfam:Spectrin 310 420 1.9e-10 PFAM
SPEC 433 533 5.22e-26 SMART
SPEC 539 637 3.45e-17 SMART
SPEC 643 761 1.31e-8 SMART
SPEC 767 869 2.94e-11 SMART
SPEC 875 975 1.49e-21 SMART
SPEC 981 1076 1.65e0 SMART
SPEC 1082 1187 2.82e-13 SMART
SPEC 1193 1293 6.59e-14 SMART
SPEC 1299 1398 4.08e-19 SMART
SPEC 1404 1503 5.92e-7 SMART
SPEC 1509 1609 2.45e-22 SMART
SPEC 1615 1715 1.45e-24 SMART
SPEC 1721 1822 1.86e-22 SMART
SPEC 1828 1930 9.54e-11 SMART
SPEC 1936 2036 1.35e-19 SMART
SPEC 2042 2292 1.06e-8 SMART
low complexity region 2352 2406 N/A INTRINSIC
PH 2410 2520 1.54e-14 SMART
low complexity region 2543 2554 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spectrin is an actin crosslinking and molecular scaffold protein that links the plasma membrane to the actin cytoskeleton, and functions in the determination of cell shape, arrangement of transmembrane proteins, and organization of organelles. It is composed of two antiparallel dimers of alpha- and beta- subunits. This gene is one member of a family of beta-spectrin genes. The encoded protein localizes to the nuclear matrix, PML nuclear bodies, and cytoplasmic vesicles. A highly similar gene in the mouse is required for localization of specific membrane proteins in polarized regions of neurons. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for spontaneous mutations exhibit tremors, progressive ataxia with hind limb paralysis, central deafness, reduced body weight, and shortened lifespan. Males are sterile, but females may breed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830473C10Rik G T 5: 90,572,783 C271F probably damaging Het
Arhgef39 C T 4: 43,497,112 G293E possibly damaging Het
Atp8a1 A C 5: 67,774,828 I206S probably benign Het
BC053393 T A 11: 46,584,420 F147L probably benign Het
Cacnb2 A T 2: 14,975,215 R290* probably null Het
Ccdc137 T C 11: 120,460,248 S159P probably damaging Het
Chil5 A G 3: 106,019,627 S231P probably damaging Het
Cic C T 7: 25,294,008 probably benign Het
Csmd3 A G 15: 47,669,185 V2434A possibly damaging Het
Csnk1a1 A G 18: 61,585,310 probably benign Het
D330045A20Rik T C X: 139,480,896 V134A possibly damaging Het
Eif4e1b T C 13: 54,784,483 S49P probably benign Het
Far1 C A 7: 113,550,001 P194Q probably benign Het
Fut4 T C 9: 14,751,381 T206A possibly damaging Het
Galnt7 G T 8: 57,552,572 S209* probably null Het
Gas2l1 A G 11: 5,063,908 V184A probably benign Het
Herc1 T C 9: 66,496,005 L4402P probably damaging Het
Hoxa13 C A 6: 52,260,729 probably benign Het
Ighv1-9 T A 12: 114,583,796 K42* probably null Het
Kif20a C T 18: 34,631,941 R743W probably damaging Het
Lama2 G A 10: 27,422,558 R181C probably damaging Het
Lrp2 G T 2: 69,506,348 T1360K probably benign Het
Map4k1 G A 7: 28,988,595 V177I probably damaging Het
Nbea G A 3: 56,082,379 T352I probably damaging Het
Nde1 A G 16: 14,188,336 T82A possibly damaging Het
Nes A G 3: 87,976,042 E536G probably damaging Het
Nms C T 1: 38,939,296 P4L probably benign Het
Nrip1 T C 16: 76,291,405 Q1088R possibly damaging Het
Nwd1 A G 8: 72,666,795 K229E probably damaging Het
Olfr583 T C 7: 103,051,811 L171P probably damaging Het
Olfr600 A G 7: 103,346,083 Y282H probably damaging Het
Pcdhac2 T A 18: 37,144,743 S259T probably benign Het
Pdcd5 T C 7: 35,646,180 D102G possibly damaging Het
Pgm2 T C 4: 99,962,140 V169A probably benign Het
Pitpnm2 C T 5: 124,142,123 E121K probably benign Het
Plin3 T C 17: 56,286,555 Y53C probably damaging Het
Poc1b T C 10: 99,155,139 probably null Het
Polr2c A T 8: 94,863,462 N232Y probably damaging Het
Ppp1r9b A T 11: 95,001,324 R188S possibly damaging Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rab3gap2 G A 1: 185,235,342 S141N probably damaging Het
Rap1gap2 C A 11: 74,407,322 A491S possibly damaging Het
Rnf166 A G 8: 122,470,240 L91P probably damaging Het
Robo2 T A 16: 73,948,266 M200L probably damaging Het
Rp1 A T 1: 4,347,924 H988Q probably benign Het
Sbno2 T C 10: 80,072,358 K69R probably null Het
Sgce G A 6: 4,691,459 A295V probably damaging Het
Shc3 C G 13: 51,480,094 probably null Het
Slc44a1 T C 4: 53,563,286 V671A probably benign Het
Stx5a A G 19: 8,749,740 T252A probably benign Het
Tmem87b C T 2: 128,846,750 A485V probably benign Het
Tns1 A G 1: 73,985,749 I403T probably damaging Het
Ttll10 G C 4: 156,048,561 T22R possibly damaging Het
Uevld A T 7: 46,940,142 S293T probably benign Het
Utp18 T C 11: 93,866,438 N467D probably damaging Het
Vmn1r39 A T 6: 66,805,361 probably null Het
Vmn2r106 A G 17: 20,285,379 S18P probably benign Het
Vmn2r61 A T 7: 42,300,733 H859L probably benign Het
Vmn2r61 T C 7: 42,300,735 S860P probably benign Het
Vmn2r72 G A 7: 85,737,828 R843* probably null Het
Vwc2 A G 11: 11,154,235 T256A probably damaging Het
Zfp715 T C 7: 43,311,092 D25G probably damaging Het
Other mutations in Sptbn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:Sptbn4 APN 7 27369434 missense probably damaging 1.00
IGL00468:Sptbn4 APN 7 27417965 missense probably damaging 1.00
IGL01396:Sptbn4 APN 7 27414771 missense probably benign 0.06
IGL01700:Sptbn4 APN 7 27404268 missense probably damaging 1.00
IGL01878:Sptbn4 APN 7 27364146 missense probably damaging 0.99
IGL02066:Sptbn4 APN 7 27364515 missense possibly damaging 0.68
IGL02116:Sptbn4 APN 7 27364357 missense probably benign
IGL02226:Sptbn4 APN 7 27365707 missense probably damaging 1.00
IGL02333:Sptbn4 APN 7 27364299 missense probably damaging 1.00
IGL02337:Sptbn4 APN 7 27428247 missense probably benign 0.03
IGL02451:Sptbn4 APN 7 27365589 missense probably null 0.15
IGL02487:Sptbn4 APN 7 27419097 missense probably damaging 1.00
IGL02530:Sptbn4 APN 7 27391551 missense probably damaging 1.00
IGL02724:Sptbn4 APN 7 27367679 missense probably damaging 1.00
IGL02850:Sptbn4 APN 7 27426833 missense possibly damaging 0.95
IGL02851:Sptbn4 APN 7 27426833 missense possibly damaging 0.95
IGL02869:Sptbn4 APN 7 27394148 splice site probably benign
IGL02961:Sptbn4 APN 7 27397967 missense probably damaging 1.00
ANU22:Sptbn4 UTSW 7 27357387 nonsense probably null
R0194:Sptbn4 UTSW 7 27404911 missense probably benign 0.00
R0328:Sptbn4 UTSW 7 27364170 missense probably damaging 1.00
R0379:Sptbn4 UTSW 7 27359736 splice site probably benign
R0510:Sptbn4 UTSW 7 27361566 critical splice donor site probably null
R0550:Sptbn4 UTSW 7 27364378 missense probably benign 0.16
R0557:Sptbn4 UTSW 7 27408328 nonsense probably null
R1336:Sptbn4 UTSW 7 27417963 missense probably damaging 1.00
R1494:Sptbn4 UTSW 7 27434294 missense probably damaging 1.00
R1630:Sptbn4 UTSW 7 27418739 missense probably benign 0.09
R1803:Sptbn4 UTSW 7 27418583 missense probably damaging 1.00
R1834:Sptbn4 UTSW 7 27366646 missense probably null 0.96
R1906:Sptbn4 UTSW 7 27391431 critical splice donor site probably null
R1924:Sptbn4 UTSW 7 27407138 missense probably damaging 1.00
R1951:Sptbn4 UTSW 7 27366443 missense possibly damaging 0.64
R1989:Sptbn4 UTSW 7 27367702 missense probably damaging 1.00
R1990:Sptbn4 UTSW 7 27423810 missense probably benign 0.19
R2005:Sptbn4 UTSW 7 27366419 nonsense probably null
R2083:Sptbn4 UTSW 7 27428256 missense probably benign 0.29
R2176:Sptbn4 UTSW 7 27364162 missense probably benign 0.21
R2211:Sptbn4 UTSW 7 27367609 missense probably damaging 1.00
R2262:Sptbn4 UTSW 7 27434357 missense probably damaging 1.00
R2263:Sptbn4 UTSW 7 27434357 missense probably damaging 1.00
R2374:Sptbn4 UTSW 7 27360092 missense probably damaging 0.99
R2407:Sptbn4 UTSW 7 27418098 nonsense probably null
R4115:Sptbn4 UTSW 7 27391570 missense probably damaging 1.00
R4116:Sptbn4 UTSW 7 27391570 missense probably damaging 1.00
R4392:Sptbn4 UTSW 7 27418471 missense probably damaging 0.97
R4535:Sptbn4 UTSW 7 27367702 missense probably damaging 1.00
R4684:Sptbn4 UTSW 7 27364419 missense probably damaging 0.96
R4684:Sptbn4 UTSW 7 27366735 missense possibly damaging 0.60
R4707:Sptbn4 UTSW 7 27417006 missense probably benign 0.12
R4876:Sptbn4 UTSW 7 27372152 missense probably damaging 1.00
R5091:Sptbn4 UTSW 7 27369391 missense probably damaging 1.00
R5371:Sptbn4 UTSW 7 27359741 critical splice donor site probably null
R5790:Sptbn4 UTSW 7 27366428 missense probably damaging 0.99
R5857:Sptbn4 UTSW 7 27418713 missense possibly damaging 0.89
R5908:Sptbn4 UTSW 7 27404253 missense probably benign 0.00
R5980:Sptbn4 UTSW 7 27372171 missense probably damaging 1.00
R6005:Sptbn4 UTSW 7 27418599 missense probably damaging 1.00
R6013:Sptbn4 UTSW 7 27364479 missense probably damaging 0.99
R6037:Sptbn4 UTSW 7 27364170 missense probably damaging 0.97
R6037:Sptbn4 UTSW 7 27364170 missense probably damaging 0.97
R6129:Sptbn4 UTSW 7 27360088 missense probably damaging 0.98
R6146:Sptbn4 UTSW 7 27364587 nonsense probably null
R6762:Sptbn4 UTSW 7 27394208 missense probably damaging 1.00
R6897:Sptbn4 UTSW 7 27371950 missense possibly damaging 0.96
R7178:Sptbn4 UTSW 7 27418056 missense probably damaging 1.00
R7212:Sptbn4 UTSW 7 27416785 missense probably benign 0.44
R7465:Sptbn4 UTSW 7 27366689 missense probably benign 0.00
R7471:Sptbn4 UTSW 7 27409014 missense possibly damaging 0.64
R7510:Sptbn4 UTSW 7 27428268 missense probably benign 0.13
R7527:Sptbn4 UTSW 7 27375590 missense possibly damaging 0.94
R7528:Sptbn4 UTSW 7 27442535 missense probably benign 0.00
R7572:Sptbn4 UTSW 7 27372272 missense probably damaging 0.99
R7649:Sptbn4 UTSW 7 27361577 missense possibly damaging 0.80
R7714:Sptbn4 UTSW 7 27364336 missense probably benign 0.02
R7780:Sptbn4 UTSW 7 27361634 missense possibly damaging 0.70
X0020:Sptbn4 UTSW 7 27402734 critical splice donor site probably null
X0066:Sptbn4 UTSW 7 27357311 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- ATGACTATGGGCTCCAGTGTG -3'
(R):5'- TTGCACATGCCCTCACATTG -3'

Sequencing Primer
(F):5'- CTATGGGCTCCAGTGTGGTTCTG -3'
(R):5'- CACATGCTTGCCTAGGCTGTAG -3'
Posted On2015-07-07