Incidental Mutation 'R4479:Slc7a11'
ID331389
Institutional Source Beutler Lab
Gene Symbol Slc7a11
Ensembl Gene ENSMUSG00000027737
Gene Namesolute carrier family 7 (cationic amino acid transporter, y+ system), member 11
Synonymssut, System x, x, 9930009M05Rik, xCT
MMRRC Submission 041736-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4479 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location49892526-50443614 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 50417963 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141988 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029297] [ENSMUST00000194462]
Predicted Effect probably benign
Transcript: ENSMUST00000029297
SMART Domains Protein: ENSMUSP00000029297
Gene: ENSMUSG00000027737

DomainStartEndE-ValueType
Pfam:AA_permease_2 44 469 3.3e-61 PFAM
Pfam:AA_permease 49 478 1.1e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142932
Predicted Effect probably benign
Transcript: ENSMUST00000194462
SMART Domains Protein: ENSMUSP00000141988
Gene: ENSMUSG00000027737

DomainStartEndE-ValueType
Pfam:AA_permease_2 44 469 1.1e-60 PFAM
Pfam:AA_permease 49 479 2e-32 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 95% (36/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a heteromeric, sodium-independent, anionic amino acid transport system that is highly specific for cysteine and glutamate. In this system, designated Xc(-), the anionic form of cysteine is transported in exchange for glutamate. This protein has been identified as the predominant mediator of Kaposi sarcoma-associated herpesvirus fusion and entry permissiveness into cells. Also, increased expression of this gene in primary gliomas (compared to normal brain tissue) was associated with increased glutamate secretion via the XCT channels, resulting in neuronal cell death. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous mutant mice show a reduction in yellow pigment resulting in dilution of agouti; only pinna hairs are affected in nonagouti mice. Mice homozygous for an ENU-induced allele exhibit decreased survival of LPS-induced macrophages and increased incidence of chemically-induced tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 T C 7: 46,005,239 T553A possibly damaging Het
Adamts20 C T 15: 94,403,445 R66H probably damaging Het
Anks1b A G 10: 90,049,892 E150G probably damaging Het
Chp2 A G 7: 122,220,918 D97G probably benign Het
Cnbd2 T C 2: 156,333,653 probably benign Het
D130040H23Rik C A 8: 69,302,503 H187N possibly damaging Het
Dusp15 A G 2: 152,944,182 L135P probably damaging Het
Eif4g1 G T 16: 20,678,843 probably benign Het
Erlin2 G T 8: 27,025,099 V10L probably benign Het
F830104G03Rik A G 3: 56,890,213 S98P unknown Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Gm3159 T C 14: 4,398,584 Y92H probably damaging Het
Ighv1-22 G T 12: 114,746,663 A15E possibly damaging Het
Ints4 T C 7: 97,484,971 S37P probably damaging Het
Irs1 G A 1: 82,287,294 T1067I probably damaging Het
Lrrc28 C T 7: 67,531,614 probably null Het
Olfr1243 A G 2: 89,528,170 I80T possibly damaging Het
Olfr1420 A G 19: 11,896,558 Y179C probably damaging Het
Olfr206 G A 16: 59,344,867 T278I probably damaging Het
Psg18 C T 7: 18,350,862 S103N probably benign Het
Psma3 T C 12: 70,984,781 probably benign Het
Tas2r115 T C 6: 132,737,532 D152G probably damaging Het
Tti1 A T 2: 158,008,395 L308Q possibly damaging Het
Unc93b1 G A 19: 3,935,236 A15T probably benign Het
Usp43 G A 11: 67,856,407 R820C possibly damaging Het
Vmn2r68 TCC TC 7: 85,221,550 probably null Het
Vps8 A T 16: 21,545,236 probably benign Het
Wdr73 T C 7: 80,893,221 E213G probably benign Het
Zfp286 C G 11: 62,780,204 G348R probably damaging Het
Zkscan5 T C 5: 145,211,174 probably benign Het
Other mutations in Slc7a11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00660:Slc7a11 APN 3 50427687 missense probably benign 0.06
IGL00990:Slc7a11 APN 3 50379069 missense probably damaging 1.00
IGL01755:Slc7a11 APN 3 50424067 missense probably benign 0.39
IGL03105:Slc7a11 APN 3 50372339 missense possibly damaging 0.67
IGL03141:Slc7a11 APN 3 50381885 missense possibly damaging 0.66
R0468:Slc7a11 UTSW 3 50384051 missense probably damaging 1.00
R0735:Slc7a11 UTSW 3 50424096 missense probably benign 0.00
R1363:Slc7a11 UTSW 3 50424051 missense probably damaging 1.00
R1466:Slc7a11 UTSW 3 50381073 splice site probably null
R1466:Slc7a11 UTSW 3 50381073 splice site probably null
R1554:Slc7a11 UTSW 3 50381896 missense probably damaging 1.00
R1734:Slc7a11 UTSW 3 50372346 nonsense probably null
R2128:Slc7a11 UTSW 3 50384109 missense probably damaging 0.97
R2504:Slc7a11 UTSW 3 50377746 splice site probably null
R3116:Slc7a11 UTSW 3 50384139 missense probably benign 0.13
R3981:Slc7a11 UTSW 3 50427774 missense probably benign
R5117:Slc7a11 UTSW 3 50379150 missense probably damaging 0.99
R5586:Slc7a11 UTSW 3 50443083 missense possibly damaging 0.95
R5621:Slc7a11 UTSW 3 50438875 missense probably damaging 1.00
R5689:Slc7a11 UTSW 3 50372331 missense probably benign 0.01
R5692:Slc7a11 UTSW 3 50372331 missense probably benign 0.01
R5965:Slc7a11 UTSW 3 50379144 missense probably benign 0.00
R6338:Slc7a11 UTSW 3 50384043 critical splice donor site probably null
R7177:Slc7a11 UTSW 3 50443231 missense probably benign 0.00
R7337:Slc7a11 UTSW 3 50442999 missense possibly damaging 0.50
R7634:Slc7a11 UTSW 3 50424037 splice site probably null
R7756:Slc7a11 UTSW 3 50372360 missense probably benign
R7758:Slc7a11 UTSW 3 50372360 missense probably benign
R7821:Slc7a11 UTSW 3 50381027 missense probably damaging 1.00
R8112:Slc7a11 UTSW 3 50417991 missense possibly damaging 0.92
R8218:Slc7a11 UTSW 3 50424052 missense probably damaging 1.00
R8255:Slc7a11 UTSW 3 50427728 missense probably damaging 0.98
R8318:Slc7a11 UTSW 3 50417986 critical splice donor site probably null
R8396:Slc7a11 UTSW 3 50384129 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- CTTTCCTACATTCAGACTATAAGGC -3'
(R):5'- AATGGGTGTTCTACTCTTACAGTCTTC -3'

Sequencing Primer
(F):5'- CTGTGAGGGGTAACTTATTATG -3'
(R):5'- GAGAGTTCTCACCAGTTGCC -3'
Posted On2015-07-21