Incidental Mutation 'R4517:Mapkbp1'
ID332941
Institutional Source Beutler Lab
Gene Symbol Mapkbp1
Ensembl Gene ENSMUSG00000033902
Gene Namemitogen-activated protein kinase binding protein 1
Synonyms2810483F24Rik, Jnkbp1
MMRRC Submission 041761-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4517 (G1)
Quality Score163
Status Validated
Chromosome2
Chromosomal Location119972699-120027408 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 120025064 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000155163 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044675] [ENSMUST00000066058] [ENSMUST00000129679] [ENSMUST00000129685] [ENSMUST00000135365] [ENSMUST00000156805] [ENSMUST00000162393] [ENSMUST00000229024]
Predicted Effect probably benign
Transcript: ENSMUST00000044675
SMART Domains Protein: ENSMUSP00000041220
Gene: ENSMUSG00000098789

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
JmjC 128 307 4.31e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000066058
SMART Domains Protein: ENSMUSP00000068516
Gene: ENSMUSG00000033902

DomainStartEndE-ValueType
WD40 80 121 8.75e-5 SMART
WD40 124 165 3.64e-2 SMART
WD40 168 205 4.62e-1 SMART
low complexity region 220 234 N/A INTRINSIC
WD40 264 301 2.65e1 SMART
WD40 332 367 1.99e0 SMART
WD40 374 422 1.29e-2 SMART
WD40 463 502 3.9e-2 SMART
WD40 505 547 2.77e-1 SMART
WD40 551 592 2.67e-1 SMART
WD40 599 639 2.21e1 SMART
WD40 642 684 5.75e-1 SMART
WD40 687 726 6.04e-8 SMART
low complexity region 736 747 N/A INTRINSIC
low complexity region 779 795 N/A INTRINSIC
low complexity region 1028 1054 N/A INTRINSIC
coiled coil region 1400 1427 N/A INTRINSIC
low complexity region 1460 1477 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129679
Predicted Effect probably benign
Transcript: ENSMUST00000129685
SMART Domains Protein: ENSMUSP00000115498
Gene: ENSMUSG00000033852

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
JmjC 128 308 1.65e-4 SMART
C2 242 342 1.79e-17 SMART
PLAc 456 1012 1.99e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130176
Predicted Effect probably benign
Transcript: ENSMUST00000135365
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139862
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141511
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148161
Predicted Effect probably benign
Transcript: ENSMUST00000156805
SMART Domains Protein: ENSMUSP00000117535
Gene: ENSMUSG00000033852

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
JmjC 128 308 1.65e-4 SMART
C2 242 342 1.79e-17 SMART
PLAc 456 892 8.56e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162393
SMART Domains Protein: ENSMUSP00000125329
Gene: ENSMUSG00000033852

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
JmjC 128 242 4.42e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000229024
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 95% (39/41)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank A G 15: 27,562,749 H181R possibly damaging Het
B4galnt4 A G 7: 141,067,722 K408E probably damaging Het
Cd209a T A 8: 3,745,525 D123V probably damaging Het
Cyp4f37 A G 17: 32,631,592 I340V probably benign Het
Echs1 A G 7: 140,112,496 S113P possibly damaging Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Fap T C 2: 62,530,715 I391V probably benign Het
Glb1l C T 1: 75,208,703 C121Y probably damaging Het
Glod4 T A 11: 76,243,571 D25V probably damaging Het
Gpc5 T A 14: 115,552,239 N508K possibly damaging Het
H2-M10.3 C T 17: 36,367,830 probably null Het
Ibsp C A 5: 104,305,997 S67* probably null Het
Ifit1bl2 C T 19: 34,629,764 probably benign Het
Iqgap2 A G 13: 95,664,061 probably null Het
Kcnma1 A G 14: 23,337,029 S982P probably damaging Het
Kif5b T C 18: 6,213,272 S707G probably benign Het
Lrrk2 A G 15: 91,705,120 I437V probably benign Het
Mcu T C 10: 59,467,634 Y127C probably damaging Het
Mlst8 T C 17: 24,476,057 Y284C probably damaging Het
Nr2f2 T G 7: 70,358,122 N204T probably benign Het
Olfr541 A G 7: 140,705,091 Y280C probably damaging Het
Olfr8 T A 10: 78,956,043 Y279* probably null Het
Pcf11 T C 7: 92,646,488 Y1451C probably damaging Het
Plekhn1 T C 4: 156,225,531 S109G probably damaging Het
Rttn T C 18: 89,028,973 S920P probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Tas2r135 A T 6: 42,406,079 H184L probably benign Het
Tmem38a C T 8: 72,572,161 P20S possibly damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Vmn2r102 A G 17: 19,681,213 Y534C probably damaging Het
Wdr62 A G 7: 30,270,258 V259A probably damaging Het
Whrn A G 4: 63,461,280 probably null Het
Other mutations in Mapkbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01102:Mapkbp1 APN 2 120021858 missense possibly damaging 0.94
IGL01309:Mapkbp1 APN 2 120018942 missense probably damaging 1.00
IGL01728:Mapkbp1 APN 2 120023821 missense probably damaging 1.00
IGL01808:Mapkbp1 APN 2 120023169 unclassified probably null
IGL02185:Mapkbp1 APN 2 120014663 missense possibly damaging 0.58
IGL02421:Mapkbp1 APN 2 120019655 missense possibly damaging 0.95
IGL02691:Mapkbp1 APN 2 119973174 splice site probably benign
IGL03146:Mapkbp1 APN 2 119998474 splice site probably benign
IGL03387:Mapkbp1 APN 2 119998498 missense probably damaging 0.99
IGL03054:Mapkbp1 UTSW 2 120015400 missense probably damaging 0.97
R0118:Mapkbp1 UTSW 2 120025215 missense probably benign 0.00
R0393:Mapkbp1 UTSW 2 120012903 splice site probably null
R0463:Mapkbp1 UTSW 2 120023151 missense probably benign 0.01
R0788:Mapkbp1 UTSW 2 120024001 missense probably benign 0.02
R0928:Mapkbp1 UTSW 2 120015368 missense probably benign 0.00
R1104:Mapkbp1 UTSW 2 120011073 splice site probably benign
R1162:Mapkbp1 UTSW 2 120025318 missense possibly damaging 0.87
R1219:Mapkbp1 UTSW 2 120019350 nonsense probably null
R1299:Mapkbp1 UTSW 2 120015404 missense probably damaging 1.00
R1300:Mapkbp1 UTSW 2 120013655 missense probably benign 0.25
R1342:Mapkbp1 UTSW 2 119998534 missense possibly damaging 0.95
R1456:Mapkbp1 UTSW 2 119973145 missense probably damaging 1.00
R1464:Mapkbp1 UTSW 2 120021261 missense probably benign
R1464:Mapkbp1 UTSW 2 120021261 missense probably benign
R1470:Mapkbp1 UTSW 2 120017820 missense probably damaging 1.00
R1470:Mapkbp1 UTSW 2 120017820 missense probably damaging 1.00
R1660:Mapkbp1 UTSW 2 120018548 missense possibly damaging 0.83
R2008:Mapkbp1 UTSW 2 120012665 missense probably damaging 1.00
R2083:Mapkbp1 UTSW 2 120015482 missense possibly damaging 0.96
R2371:Mapkbp1 UTSW 2 120010780 missense probably damaging 1.00
R2423:Mapkbp1 UTSW 2 120024590 missense probably benign 0.00
R3976:Mapkbp1 UTSW 2 120021858 missense possibly damaging 0.94
R4009:Mapkbp1 UTSW 2 120023605 missense probably benign 0.00
R4183:Mapkbp1 UTSW 2 120017865 missense probably damaging 1.00
R4246:Mapkbp1 UTSW 2 120013027 missense probably damaging 1.00
R4503:Mapkbp1 UTSW 2 120015706 missense probably damaging 1.00
R4513:Mapkbp1 UTSW 2 120023693 missense possibly damaging 0.63
R4742:Mapkbp1 UTSW 2 120016818 missense probably damaging 1.00
R5049:Mapkbp1 UTSW 2 120015501 splice site probably benign
R5079:Mapkbp1 UTSW 2 120013733 missense probably damaging 0.99
R5137:Mapkbp1 UTSW 2 120022181 missense probably damaging 1.00
R5255:Mapkbp1 UTSW 2 120017254 missense probably damaging 1.00
R5530:Mapkbp1 UTSW 2 120015355 missense probably benign
R5546:Mapkbp1 UTSW 2 120019243 missense probably damaging 1.00
R5634:Mapkbp1 UTSW 2 119973095 missense probably damaging 1.00
R5696:Mapkbp1 UTSW 2 120021720 splice site probably null
R5891:Mapkbp1 UTSW 2 120023932 nonsense probably null
R6263:Mapkbp1 UTSW 2 120023291 missense probably damaging 1.00
R6807:Mapkbp1 UTSW 2 120021159 missense probably damaging 0.99
R6890:Mapkbp1 UTSW 2 120015802 missense probably damaging 1.00
R7159:Mapkbp1 UTSW 2 120025132 missense possibly damaging 0.72
R7467:Mapkbp1 UTSW 2 120022188 missense probably damaging 1.00
R7536:Mapkbp1 UTSW 2 120018585 missense probably damaging 1.00
R7564:Mapkbp1 UTSW 2 120013751 missense probably benign 0.09
R7801:Mapkbp1 UTSW 2 120012073 missense probably damaging 1.00
R7886:Mapkbp1 UTSW 2 120012647 missense possibly damaging 0.90
R7969:Mapkbp1 UTSW 2 120012647 missense possibly damaging 0.90
R8095:Mapkbp1 UTSW 2 120017650 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- GGTTTGGGCACTTTAGATAGAAGAAAC -3'
(R):5'- GCAGTAGCTCGGAGTATTGC -3'

Sequencing Primer
(F):5'- TCACATTTGAAAGAGTTGTTGGG -3'
(R):5'- AGTATTGCTCCAACAGGGC -3'
Posted On2015-08-18