Incidental Mutation 'R4529:Xpo7'
ID333048
Institutional Source Beutler Lab
Gene Symbol Xpo7
Ensembl Gene ENSMUSG00000022100
Gene Nameexportin 7
Synonyms4930506C02Rik, Ranbp16
MMRRC Submission 041592-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.260) question?
Stock #R4529 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location70654246-70766628 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 70668748 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 986 (T986M)
Ref Sequence ENSEMBL: ENSMUSP00000154350 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022696] [ENSMUST00000167242] [ENSMUST00000226448] [ENSMUST00000228346]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022696
AA Change: T985M

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000022696
Gene: ENSMUSG00000022100
AA Change: T985M

DomainStartEndE-ValueType
IBN_N 30 96 3.52e-6 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000167242
AA Change: T986M

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000129504
Gene: ENSMUSG00000022100
AA Change: T986M

DomainStartEndE-ValueType
IBN_N 30 96 3.52e-6 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000226448
AA Change: T985M

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226607
Predicted Effect probably damaging
Transcript: ENSMUST00000228346
AA Change: T986M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The transport of protein and large RNAs through the nuclear pore complexes (NPC) is an energy-dependent and regulated process. The import of proteins with a nuclear localization signal (NLS) is accomplished by recognition of one or more clusters of basic amino acids by the importin-alpha/beta complex; see MIM 600685 and MIM 602738. The small GTPase RAN (MIM 601179) plays a key role in NLS-dependent protein import. RAN-binding protein-16 is a member of the importin-beta superfamily of nuclear transport receptors.[supplied by OMIM, Jul 2002]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre1 A G 17: 57,420,519 Y483C possibly damaging Het
Akap9 T A 5: 4,043,948 F2157I probably damaging Het
Aldh1a3 T C 7: 66,401,994 N404D probably benign Het
Ankrd2 A T 19: 42,043,801 I231F probably benign Het
Apba1 A G 19: 23,936,535 N641D probably damaging Het
C1qbp T C 11: 70,978,724 T178A probably benign Het
Chtf18 T C 17: 25,720,618 Y64C probably damaging Het
Cyp1a1 A G 9: 57,701,679 H281R probably benign Het
Ehmt2 A G 17: 34,913,731 I1235V probably damaging Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Fcamr A G 1: 130,804,576 H44R probably damaging Het
Gm12185 T C 11: 48,907,920 Y582C probably damaging Het
Gm12185 T C 11: 48,908,094 N524S possibly damaging Het
Gm5460 A C 14: 34,045,812 D459A probably damaging Het
H2-Q6 C T 17: 35,425,844 T203I probably null Het
Inmt T C 6: 55,171,027 M206V probably benign Het
Khdc3 T C 9: 73,104,019 S360P possibly damaging Het
Lin54 G A 5: 100,446,560 T582I possibly damaging Het
Ltbp1 T G 17: 75,151,360 V312G probably benign Het
Nlrp9a T C 7: 26,571,407 L899P probably damaging Het
Olfr786 T C 10: 129,437,418 V202A probably benign Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Pappa A G 4: 65,231,182 I920V probably benign Het
Parp1 T A 1: 180,591,312 V679E probably damaging Het
Pla2g4f C T 2: 120,300,619 R785Q probably damaging Het
Plbd1 T A 6: 136,651,825 I82F probably benign Het
Plekhm3 A G 1: 64,937,825 V162A probably benign Het
Plin4 A G 17: 56,104,274 L919P probably damaging Het
Plxna4 C T 6: 32,496,896 probably null Het
Pou3f3 C A 1: 42,698,554 T470K probably benign Het
Prss38 T C 11: 59,373,499 Y214C probably damaging Het
Retreg1 T A 15: 25,968,514 Y109N probably damaging Het
Slco1c1 A G 6: 141,555,181 Y413C probably damaging Het
Stk32a T C 18: 43,242,979 C38R possibly damaging Het
Themis T C 10: 28,782,335 F453L possibly damaging Het
Tmem38a C T 8: 72,572,161 P20S possibly damaging Het
Tubgcp3 G T 8: 12,663,932 L62I probably damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Zfp51 C T 17: 21,464,736 L538F probably damaging Het
Zfy1 A G Y: 726,511 L418S possibly damaging Het
Other mutations in Xpo7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00946:Xpo7 APN 14 70671658 missense probably benign 0.32
IGL01066:Xpo7 APN 14 70701755 missense probably benign 0.01
IGL01610:Xpo7 APN 14 70703230 missense probably damaging 1.00
IGL01716:Xpo7 APN 14 70685555 missense probably damaging 1.00
IGL01885:Xpo7 APN 14 70666035 missense probably benign 0.03
IGL02647:Xpo7 APN 14 70685465 missense probably damaging 1.00
IGL03088:Xpo7 APN 14 70681262 missense probably benign 0.09
IGL03245:Xpo7 APN 14 70688294 missense probably damaging 1.00
froggie UTSW 14 70682347 missense probably damaging 1.00
BB010:Xpo7 UTSW 14 70707348 missense probably benign 0.05
BB020:Xpo7 UTSW 14 70707348 missense probably benign 0.05
PIT4687001:Xpo7 UTSW 14 70667149 missense probably benign 0.22
R0893:Xpo7 UTSW 14 70666097 splice site probably benign
R1222:Xpo7 UTSW 14 70667084 missense possibly damaging 0.55
R1474:Xpo7 UTSW 14 70699033 missense probably benign 0.00
R1509:Xpo7 UTSW 14 70678142 missense probably damaging 0.99
R1867:Xpo7 UTSW 14 70693991 missense probably damaging 1.00
R1898:Xpo7 UTSW 14 70695624 missense probably benign 0.20
R2105:Xpo7 UTSW 14 70690991 missense probably benign 0.02
R2369:Xpo7 UTSW 14 70687731 nonsense probably null
R2937:Xpo7 UTSW 14 70671690 missense probably damaging 0.99
R2938:Xpo7 UTSW 14 70671690 missense probably damaging 0.99
R2940:Xpo7 UTSW 14 70667136 missense probably damaging 1.00
R2940:Xpo7 UTSW 14 70667137 missense probably benign 0.38
R3001:Xpo7 UTSW 14 70692645 splice site probably benign
R4436:Xpo7 UTSW 14 70669429 missense probably damaging 1.00
R4873:Xpo7 UTSW 14 70676816 critical splice acceptor site probably null
R4875:Xpo7 UTSW 14 70676816 critical splice acceptor site probably null
R4907:Xpo7 UTSW 14 70670629 missense probably benign 0.16
R5007:Xpo7 UTSW 14 70688264 missense probably damaging 1.00
R5282:Xpo7 UTSW 14 70683731 missense probably damaging 1.00
R5346:Xpo7 UTSW 14 70683677 missense probably damaging 1.00
R5522:Xpo7 UTSW 14 70671650 nonsense probably null
R5533:Xpo7 UTSW 14 70693967 missense probably damaging 1.00
R5668:Xpo7 UTSW 14 70682846 missense possibly damaging 0.52
R6042:Xpo7 UTSW 14 70695663 missense possibly damaging 0.47
R6052:Xpo7 UTSW 14 70683719 missense possibly damaging 0.68
R6066:Xpo7 UTSW 14 70682338 missense probably null 0.99
R6085:Xpo7 UTSW 14 70696611 missense probably benign 0.38
R6180:Xpo7 UTSW 14 70682803 missense probably benign 0.14
R6291:Xpo7 UTSW 14 70704690 nonsense probably null
R6401:Xpo7 UTSW 14 70682347 missense probably damaging 1.00
R6593:Xpo7 UTSW 14 70682362 missense probably damaging 0.99
R6725:Xpo7 UTSW 14 70676813 missense probably damaging 1.00
R6938:Xpo7 UTSW 14 70666024 missense probably benign 0.00
R6996:Xpo7 UTSW 14 70669448 missense probably benign
R7020:Xpo7 UTSW 14 70666023 missense probably benign 0.00
R7053:Xpo7 UTSW 14 70684858 critical splice donor site probably null
R7061:Xpo7 UTSW 14 70671072 missense probably benign 0.04
R7095:Xpo7 UTSW 14 70704706 missense probably damaging 1.00
R7604:Xpo7 UTSW 14 70671670 missense probably damaging 1.00
R7933:Xpo7 UTSW 14 70707348 missense probably benign 0.05
R8044:Xpo7 UTSW 14 70684926 missense probably benign 0.18
R8438:Xpo7 UTSW 14 70703232 missense probably benign 0.02
R8518:Xpo7 UTSW 14 70707397 missense probably damaging 1.00
X0062:Xpo7 UTSW 14 70685528 missense probably damaging 1.00
Z1176:Xpo7 UTSW 14 70692710 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- ACACACGCTCTCTTGAGGAG -3'
(R):5'- CTCACTGCAGGGAAATGGAG -3'

Sequencing Primer
(F):5'- TTCCAAGAGTACCAGGTACCATGTG -3'
(R):5'- TGGATGTGCAAAGGCCCTG -3'
Posted On2015-08-18