Incidental Mutation 'R4529:Zfy1'
ID333062
Institutional Source Beutler Lab
Gene Symbol Zfy1
Ensembl Gene ENSMUSG00000053211
Gene Namezinc finger protein 1, Y-linked
SynonymsZfy-1
MMRRC Submission 041592-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.047) question?
Stock #R4529 (G1)
Quality Score222
Status Not validated
ChromosomeY
Chromosomal Location725128-797409 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 726511 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Serine at position 418 (L418S)
Ref Sequence ENSEMBL: ENSMUSP00000140600 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065545] [ENSMUST00000189888]
Predicted Effect possibly damaging
Transcript: ENSMUST00000065545
AA Change: L418S

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000069364
Gene: ENSMUSG00000053211
AA Change: L418S

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
Pfam:Zfx_Zfy_act 68 388 1.1e-109 PFAM
ZnF_C2H2 403 425 1.95e-3 SMART
ZnF_C2H2 434 456 1.26e-2 SMART
ZnF_C2H2 466 488 1.05e1 SMART
ZnF_C2H2 497 520 1.41e0 SMART
ZnF_C2H2 526 548 3.69e-4 SMART
ZnF_C2H2 554 577 3.63e-3 SMART
ZnF_C2H2 583 605 8.98e0 SMART
ZnF_C2H2 611 634 3.58e-2 SMART
ZnF_C2H2 640 662 2.95e-3 SMART
ZnF_C2H2 668 691 3.47e0 SMART
ZnF_C2H2 697 719 1.45e-2 SMART
ZnF_C2H2 725 748 1.2e-3 SMART
ZnF_C2H2 754 776 5.81e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000189888
AA Change: L418S

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000140600
Gene: ENSMUSG00000053211
AA Change: L418S

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
Pfam:Zfx_Zfy_act 67 388 1.2e-141 PFAM
ZnF_C2H2 403 425 1.95e-3 SMART
ZnF_C2H2 434 456 1.26e-2 SMART
ZnF_C2H2 466 488 1.05e1 SMART
ZnF_C2H2 497 520 1.41e0 SMART
ZnF_C2H2 526 548 3.69e-4 SMART
ZnF_C2H2 554 577 3.63e-3 SMART
ZnF_C2H2 583 605 8.98e0 SMART
ZnF_C2H2 611 634 3.58e-2 SMART
ZnF_C2H2 640 662 2.95e-3 SMART
ZnF_C2H2 668 691 3.47e0 SMART
ZnF_C2H2 697 719 1.45e-2 SMART
ZnF_C2H2 725 748 1.2e-3 SMART
ZnF_C2H2 754 776 5.81e-2 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre1 A G 17: 57,420,519 Y483C possibly damaging Het
Akap9 T A 5: 4,043,948 F2157I probably damaging Het
Aldh1a3 T C 7: 66,401,994 N404D probably benign Het
Ankrd2 A T 19: 42,043,801 I231F probably benign Het
Apba1 A G 19: 23,936,535 N641D probably damaging Het
C1qbp T C 11: 70,978,724 T178A probably benign Het
Chtf18 T C 17: 25,720,618 Y64C probably damaging Het
Cyp1a1 A G 9: 57,701,679 H281R probably benign Het
Ehmt2 A G 17: 34,913,731 I1235V probably damaging Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Fcamr A G 1: 130,804,576 H44R probably damaging Het
Gm12185 T C 11: 48,907,920 Y582C probably damaging Het
Gm12185 T C 11: 48,908,094 N524S possibly damaging Het
Gm5460 A C 14: 34,045,812 D459A probably damaging Het
H2-Q6 C T 17: 35,425,844 T203I probably null Het
Inmt T C 6: 55,171,027 M206V probably benign Het
Khdc3 T C 9: 73,104,019 S360P possibly damaging Het
Lin54 G A 5: 100,446,560 T582I possibly damaging Het
Ltbp1 T G 17: 75,151,360 V312G probably benign Het
Nlrp9a T C 7: 26,571,407 L899P probably damaging Het
Olfr786 T C 10: 129,437,418 V202A probably benign Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Pappa A G 4: 65,231,182 I920V probably benign Het
Parp1 T A 1: 180,591,312 V679E probably damaging Het
Pla2g4f C T 2: 120,300,619 R785Q probably damaging Het
Plbd1 T A 6: 136,651,825 I82F probably benign Het
Plekhm3 A G 1: 64,937,825 V162A probably benign Het
Plin4 A G 17: 56,104,274 L919P probably damaging Het
Plxna4 C T 6: 32,496,896 probably null Het
Pou3f3 C A 1: 42,698,554 T470K probably benign Het
Prss38 T C 11: 59,373,499 Y214C probably damaging Het
Retreg1 T A 15: 25,968,514 Y109N probably damaging Het
Slco1c1 A G 6: 141,555,181 Y413C probably damaging Het
Stk32a T C 18: 43,242,979 C38R possibly damaging Het
Themis T C 10: 28,782,335 F453L possibly damaging Het
Tmem38a C T 8: 72,572,161 P20S possibly damaging Het
Tubgcp3 G T 8: 12,663,932 L62I probably damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Xpo7 G A 14: 70,668,748 T986M probably damaging Het
Zfp51 C T 17: 21,464,736 L538F probably damaging Het
Other mutations in Zfy1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0149:Zfy1 UTSW Y 726121 missense possibly damaging 0.95
R0361:Zfy1 UTSW Y 726121 missense possibly damaging 0.95
R0529:Zfy1 UTSW Y 726040 missense probably damaging 1.00
R0837:Zfy1 UTSW Y 725850 nonsense probably null
R0945:Zfy1 UTSW Y 725983 missense probably damaging 0.98
R1163:Zfy1 UTSW Y 725611 missense probably damaging 0.98
R1394:Zfy1 UTSW Y 725957 missense possibly damaging 0.79
R1806:Zfy1 UTSW Y 725620 missense possibly damaging 0.88
R1928:Zfy1 UTSW Y 729733 missense unknown
R2374:Zfy1 UTSW Y 726391 missense probably damaging 0.99
R2374:Zfy1 UTSW Y 726392 missense possibly damaging 0.77
R2889:Zfy1 UTSW Y 726307 missense possibly damaging 0.95
R2980:Zfy1 UTSW Y 739054 missense unknown
R3437:Zfy1 UTSW Y 726357 missense possibly damaging 0.82
R4454:Zfy1 UTSW Y 725518 missense possibly damaging 0.86
R4656:Zfy1 UTSW Y 729626 missense unknown
R5049:Zfy1 UTSW Y 726004 missense possibly damaging 0.93
R5087:Zfy1 UTSW Y 732964 missense unknown
R5347:Zfy1 UTSW Y 725950 missense possibly damaging 0.90
R5428:Zfy1 UTSW Y 726205 missense possibly damaging 0.95
R5825:Zfy1 UTSW Y 726531 missense possibly damaging 0.85
R6256:Zfy1 UTSW Y 738765 missense unknown
R7065:Zfy1 UTSW Y 725428 missense probably benign 0.33
R7134:Zfy1 UTSW Y 725788 missense probably damaging 0.99
R7185:Zfy1 UTSW Y 725464 missense possibly damaging 0.53
R7358:Zfy1 UTSW Y 735141 missense unknown
R7513:Zfy1 UTSW Y 759852 missense unknown
R7747:Zfy1 UTSW Y 725496 nonsense probably null
R7900:Zfy1 UTSW Y 725519 missense possibly damaging 0.53
R8052:Zfy1 UTSW Y 726004 missense possibly damaging 0.93
R8377:Zfy1 UTSW Y 725723 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- GAAAGATTCTTCCTACAGTCATCAC -3'
(R):5'- AGGCCTCTAATGTGATAAAGCTTC -3'

Sequencing Primer
(F):5'- ATTCTTCCTACAGTCATCACATTCAG -3'
(R):5'- AATCCAATCATAGTGAATCAGGTTC -3'
Posted On2015-08-18