Incidental Mutation 'R4529:Pla2g4f'
ID333023
Institutional Source Beutler Lab
Gene Symbol Pla2g4f
Ensembl Gene ENSMUSG00000046971
Gene Namephospholipase A2, group IVF
Synonyms4732472I07Rik, Pla2zeta
MMRRC Submission 041592-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R4529 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location120299957-120314165 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 120300619 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 785 (R785Q)
Ref Sequence ENSEMBL: ENSMUSP00000062607 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054651]
Predicted Effect probably damaging
Transcript: ENSMUST00000054651
AA Change: R785Q

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000062607
Gene: ENSMUSG00000046971
AA Change: R785Q

DomainStartEndE-ValueType
C2 45 144 7.51e-11 SMART
PLAc 285 797 1.6e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142183
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre1 A G 17: 57,420,519 Y483C possibly damaging Het
Akap9 T A 5: 4,043,948 F2157I probably damaging Het
Aldh1a3 T C 7: 66,401,994 N404D probably benign Het
Ankrd2 A T 19: 42,043,801 I231F probably benign Het
Apba1 A G 19: 23,936,535 N641D probably damaging Het
C1qbp T C 11: 70,978,724 T178A probably benign Het
Chtf18 T C 17: 25,720,618 Y64C probably damaging Het
Cyp1a1 A G 9: 57,701,679 H281R probably benign Het
Ehmt2 A G 17: 34,913,731 I1235V probably damaging Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Fcamr A G 1: 130,804,576 H44R probably damaging Het
Gm12185 T C 11: 48,907,920 Y582C probably damaging Het
Gm12185 T C 11: 48,908,094 N524S possibly damaging Het
Gm5460 A C 14: 34,045,812 D459A probably damaging Het
H2-Q6 C T 17: 35,425,844 T203I probably null Het
Inmt T C 6: 55,171,027 M206V probably benign Het
Khdc3 T C 9: 73,104,019 S360P possibly damaging Het
Lin54 G A 5: 100,446,560 T582I possibly damaging Het
Ltbp1 T G 17: 75,151,360 V312G probably benign Het
Nlrp9a T C 7: 26,571,407 L899P probably damaging Het
Olfr786 T C 10: 129,437,418 V202A probably benign Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Pappa A G 4: 65,231,182 I920V probably benign Het
Parp1 T A 1: 180,591,312 V679E probably damaging Het
Plbd1 T A 6: 136,651,825 I82F probably benign Het
Plekhm3 A G 1: 64,937,825 V162A probably benign Het
Plin4 A G 17: 56,104,274 L919P probably damaging Het
Plxna4 C T 6: 32,496,896 probably null Het
Pou3f3 C A 1: 42,698,554 T470K probably benign Het
Prss38 T C 11: 59,373,499 Y214C probably damaging Het
Retreg1 T A 15: 25,968,514 Y109N probably damaging Het
Slco1c1 A G 6: 141,555,181 Y413C probably damaging Het
Stk32a T C 18: 43,242,979 C38R possibly damaging Het
Themis T C 10: 28,782,335 F453L possibly damaging Het
Tmem38a C T 8: 72,572,161 P20S possibly damaging Het
Tubgcp3 G T 8: 12,663,932 L62I probably damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Xpo7 G A 14: 70,668,748 T986M probably damaging Het
Zfp51 C T 17: 21,464,736 L538F probably damaging Het
Zfy1 A G Y: 726,511 L418S possibly damaging Het
Other mutations in Pla2g4f
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Pla2g4f APN 2 120302738 missense possibly damaging 0.53
IGL01652:Pla2g4f APN 2 120302235 missense possibly damaging 0.86
IGL02792:Pla2g4f APN 2 120303369 missense probably damaging 1.00
R0625:Pla2g4f UTSW 2 120305041 missense probably damaging 1.00
R1760:Pla2g4f UTSW 2 120314066 unclassified probably benign
R1799:Pla2g4f UTSW 2 120311068 missense possibly damaging 0.49
R2212:Pla2g4f UTSW 2 120303106 missense probably benign
R2351:Pla2g4f UTSW 2 120300442 missense probably benign 0.01
R3412:Pla2g4f UTSW 2 120303106 missense probably benign
R3414:Pla2g4f UTSW 2 120303106 missense probably benign
R3906:Pla2g4f UTSW 2 120300499 missense probably benign 0.28
R4084:Pla2g4f UTSW 2 120312325 missense probably benign 0.36
R4477:Pla2g4f UTSW 2 120303672 missense probably damaging 1.00
R4606:Pla2g4f UTSW 2 120313986 missense probably benign 0.00
R4685:Pla2g4f UTSW 2 120305015 missense probably damaging 1.00
R4728:Pla2g4f UTSW 2 120300921 missense probably benign 0.19
R4782:Pla2g4f UTSW 2 120303276 missense probably damaging 1.00
R4957:Pla2g4f UTSW 2 120300499 missense probably benign 0.28
R5781:Pla2g4f UTSW 2 120305023 missense probably damaging 0.97
R6158:Pla2g4f UTSW 2 120301071 missense probably benign 0.21
R6232:Pla2g4f UTSW 2 120302221 missense possibly damaging 0.63
R6629:Pla2g4f UTSW 2 120308242 missense probably damaging 1.00
R6894:Pla2g4f UTSW 2 120303596 missense probably benign 0.44
R6939:Pla2g4f UTSW 2 120307301 missense probably damaging 1.00
R7131:Pla2g4f UTSW 2 120304554 missense probably null 0.01
R7221:Pla2g4f UTSW 2 120300995 missense probably benign 0.06
R7421:Pla2g4f UTSW 2 120307256 missense probably benign 0.07
R7767:Pla2g4f UTSW 2 120305009 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- ACTCTCATGTGATCAGCCCC -3'
(R):5'- GTGTCCACAATGAGCCATCTC -3'

Sequencing Primer
(F):5'- TGTGATCAGCCCCCAACC -3'
(R):5'- CAATGAGCCATCTCTTTCTAATGGG -3'
Posted On2015-08-18