Mutagenetix > Incidental Mutations

Incidental Mutation 'R0107:Ptprn'

33294

Institutional Source

Beutler Lab

Gene Symbol

Ptprn

Ensembl Gene

ENSMUSG00000026204

Gene Name

protein tyrosine phosphatase, receptor type, N

Synonyms

IA-2

MMRRC Submission

038393-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.581) question?

Stock #

R0107 (G1)

Quality Score

187

Status

Validated (trace)

Chromosome

Chromosomal Location

75247027-75264502 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 75255712 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Methionine at position 453 (L453M)

Ref Sequence

ENSEMBL: ENSMUSP00000027404 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027404] [ENSMUST00000185849] [ENSMUST00000186178] [ENSMUST00000189769]

Predicted Effect

probably damaging
Transcript: ENSMUST00000027404
AA Change: L453M

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000027404
Gene: ENSMUSG00000026204
AA Change: L453M

Domain	Start	End	E-Value	Type
signal peptide	1	37	N/A	INTRINSIC
RESP18	63	164	1.5e-51	SMART
low complexity region	174	201	N/A	INTRINSIC
low complexity region	217	235	N/A	INTRINSIC
low complexity region	360	368	N/A	INTRINSIC
Pfam:Receptor_IA-2	471	559	7e-33	PFAM
transmembrane domain	579	601	N/A	INTRINSIC
low complexity region	650	679	N/A	INTRINSIC
PTPc	710	973	1.2e-112	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000185849

SMART Domains

Protein: ENSMUSP00000140062
Gene: ENSMUSG00000026204

Domain	Start	End	E-Value	Type
RESP18	1	62	5e-10	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000186178

SMART Domains

Protein: ENSMUSP00000139925
Gene: ENSMUSG00000026204

Domain	Start	End	E-Value	Type
RESP18	27	128	1.5e-51	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000187216

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000188401

Predicted Effect

probably benign
Transcript: ENSMUST00000189769

SMART Domains

Protein: ENSMUSP00000140168
Gene: ENSMUSG00000026204

Domain	Start	End	E-Value	Type
RESP18	56	157	1.5e-51	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000191154

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.8%
20x: 90.6%

Validation Efficiency

99% (71/72)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and a single catalytic domain, and thus represents a receptor-type PTP. This PTP was found to be an autoantigen that is reactive with insulin-dependent diabetes mellitus (IDDM) patient sera, and thus may be a potential target of autoimmunity in diabetes mellitus. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Dec 2010]
PHENOTYPE: Mice homozygous for a disruption in this gene on a NOD background display insulitis and increased susceptibility to autoimmune diabetes. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca1	A	G	4: 53,080,834	V825A	probably benign	Het
Adamts7	T	C	9: 90,180,720	I409T	possibly damaging	Het
Adck1	T	C	12: 88,446,656	W253R	possibly damaging	Het
Afg3l2	A	G	18: 67,431,766	F213L	probably damaging	Het
Ankle2	T	C	5: 110,253,027	V743A	probably benign	Het
Ankrd34c	C	T	9: 89,729,484	R268H	probably benign	Het
Bcl2	G	A	1: 106,712,562	R107C	probably damaging	Het
Ccdc7b	T	G	8: 129,178,197		probably benign	Het
Cd320	A	T	17: 33,848,085	M169L	probably benign	Het
Chn1	A	G	2: 73,614,684	Y338H	probably damaging	Het
Chuk	T	A	19: 44,096,919	S263C	probably damaging	Het
Dennd4b	C	A	3: 90,272,736	P663T	possibly damaging	Het
Dnajc24	T	G	2: 106,001,914		probably benign	Het
Fam172a	A	G	13: 77,902,814	D145G	probably damaging	Het
Fbn2	A	G	18: 58,056,203	V1617A	probably benign	Het
Fermt2	T	C	14: 45,464,822	N502D	probably damaging	Het
Frrs1	A	T	3: 116,896,716	I3F	probably damaging	Het
Fut1	C	A	7: 45,618,846	Q20K	possibly damaging	Het
Gbf1	T	C	19: 46,284,828	V1709A	probably benign	Het
Gfra3	G	T	18: 34,711,306	H60Q	probably benign	Het
Gm10750	T	A	2: 149,016,053	M93L	unknown	Het
Gm5538	T	A	3: 59,752,316	L397I	possibly damaging	Het
Hmcn1	T	A	1: 150,587,015	I5124L	probably benign	Het
Hps3	A	C	3: 20,030,796	L76R	probably damaging	Het
Ifrd1	T	A	12: 40,214,081	Q105L	probably damaging	Het
Irs2	A	T	8: 11,004,691	V1247E	probably damaging	Het
Itgal	T	C	7: 127,328,559		probably benign	Het
Ivns1abp	A	T	1: 151,361,570	N495I	probably damaging	Het
Kank1	T	A	19: 25,430,366		probably benign	Het
Mroh8	T	C	2: 157,225,468	Q657R	probably benign	Het
Mthfd1l	T	C	10: 4,041,838	Y597H	probably benign	Het
Myom1	G	A	17: 71,077,365	V692I	probably damaging	Het
Olfr347	T	G	2: 36,734,718	Y132*	probably null	Het
Olfr45	A	T	7: 140,691,345	M147L	probably benign	Het
Olfr835	A	G	9: 19,035,333	D70G	probably damaging	Het
Palmd	A	T	3: 116,924,076	H257Q	probably damaging	Het
Pcnx2	A	T	8: 125,753,586	V1994D	probably benign	Het
Phkb	G	A	8: 86,016,931	G553S	probably benign	Het
Plekha5	G	A	6: 140,591,747	R646K	possibly damaging	Het
Ptprz1	T	A	6: 23,000,570	D886E	probably damaging	Het
Rcn1	T	A	2: 105,394,781	I110F	possibly damaging	Het
Scn1a	T	A	2: 66,324,633	T661S	probably benign	Het
Slc6a19	A	G	13: 73,684,057	Y467H	possibly damaging	Het
Slc9c1	T	A	16: 45,575,420	D611E	probably benign	Het
Slitrk6	T	C	14: 110,751,963	E104G	possibly damaging	Het
Spag17	A	T	3: 100,050,787	K920N	possibly damaging	Het
St3gal5	A	G	6: 72,142,149	S82G	probably benign	Het
Tlk1	T	C	2: 70,713,989	*767W	probably null	Het
Tln2	A	G	9: 67,370,706	V342A	probably damaging	Het
Tmem104	T	A	11: 115,202,180	M132K	probably damaging	Het
Tmem184c	A	G	8: 77,597,073	S387P	possibly damaging	Het
Tmtc1	A	G	6: 148,425,913	V34A	possibly damaging	Het
Trim46	A	G	3: 89,236,333	F596S	probably damaging	Het
Unc79	T	A	12: 103,134,525	D1870E	possibly damaging	Het
Utp20	T	C	10: 88,778,391	T1234A	probably benign	Het
Vmn1r31	T	A	6: 58,472,743	T46S	probably benign	Het
Vps13a	A	T	19: 16,691,824	L1341Q	probably benign	Het
Wdr72	A	T	9: 74,210,433	D821V	probably damaging	Het
Zfhx4	T	C	3: 5,398,982	L1400P	probably damaging	Het
Zfp217	T	A	2: 170,114,874	K735*	probably null	Het
Zfp235	A	G	7: 24,137,116	Q29R	probably damaging	Het
Zfp628	A	G	7: 4,920,168	Y463C	probably damaging	Het
Zkscan4	A	G	13: 21,484,581	T401A	possibly damaging	Het

Other mutations in Ptprn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01772:Ptprn	APN	1	75252270	missense	probably damaging	0.99
IGL01900:Ptprn	APN	1	75252248	splice site	probably benign
IGL02189:Ptprn	APN	1	75258495	missense	possibly damaging	0.73
IGL02282:Ptprn	APN	1	75253156	missense	probably damaging	1.00
IGL02452:Ptprn	APN	1	75258169	missense	probably benign	0.34
IGL02865:Ptprn	APN	1	75262363	missense	probably damaging	1.00
IGL02926:Ptprn	APN	1	75247873	missense	possibly damaging	0.95
IGL03062:Ptprn	APN	1	75247873	missense	possibly damaging	0.95
Delusion	UTSW	1	75248166	missense	probably damaging	1.00
H8562:Ptprn	UTSW	1	75254620	missense	possibly damaging	0.66
R0051:Ptprn	UTSW	1	75252254	critical splice donor site	probably null
R0801:Ptprn	UTSW	1	75252265	missense	probably damaging	1.00
R0865:Ptprn	UTSW	1	75248138	splice site	probably null
R1120:Ptprn	UTSW	1	75258181	missense	probably benign	0.00
R1534:Ptprn	UTSW	1	75257943	critical splice donor site	probably null
R1740:Ptprn	UTSW	1	75262050	missense	probably damaging	1.00
R1857:Ptprn	UTSW	1	75247905	missense	possibly damaging	0.64
R1927:Ptprn	UTSW	1	75254122	missense	probably benign	0.00
R1974:Ptprn	UTSW	1	75254820	splice site	probably null
R2071:Ptprn	UTSW	1	75255144	missense	probably damaging	1.00
R2223:Ptprn	UTSW	1	75257937	unclassified	probably benign
R3714:Ptprn	UTSW	1	75252767	splice site	probably null
R4617:Ptprn	UTSW	1	75252287	missense	possibly damaging	0.74
R4832:Ptprn	UTSW	1	75258265	missense	probably benign	0.37
R5503:Ptprn	UTSW	1	75251875	missense	probably damaging	1.00
R5926:Ptprn	UTSW	1	75254598	missense	probably damaging	1.00
R6217:Ptprn	UTSW	1	75248166	missense	probably damaging	1.00
R6419:Ptprn	UTSW	1	75264037	missense	probably benign	0.10
R6793:Ptprn	UTSW	1	75258142	missense	probably benign	0.38
R6964:Ptprn	UTSW	1	75260649	missense	possibly damaging	0.83
R7071:Ptprn	UTSW	1	75260619	missense	possibly damaging	0.82
R7680:Ptprn	UTSW	1	75247893	missense	probably benign	0.16
R7777:Ptprn	UTSW	1	75252302	missense	possibly damaging	0.54
R7883:Ptprn	UTSW	1	75262363	missense	probably damaging	1.00
R8233:Ptprn	UTSW	1	75253152	missense	probably damaging	1.00
R8243:Ptprn	UTSW	1	75252535	missense	probably damaging	0.99
X0017:Ptprn	UTSW	1	75253265	missense	probably benign	0.15
Z1088:Ptprn	UTSW	1	75260620	missense	possibly damaging	0.70
Z1176:Ptprn	UTSW	1	75251818	missense	probably damaging	0.99
Z1177:Ptprn	UTSW	1	75258037	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- TGCTTCTTGCCAGACAGGCTAAC -3'
(R):5'- TTAGAGCCCAAAGTGTGACCGC -3'

Sequencing Primer
(F):5'- CCCAATCCCATAGGGACTGG -3'
(R):5'- TCTAGAAGTCACGCCTGCATC -3'

Posted On

2013-05-09