Incidental Mutation 'R0107:Ivns1abp'
Institutional Source Beutler Lab
Gene Symbol Ivns1abp
Ensembl Gene ENSMUSG00000023150
Gene Nameinfluenza virus NS1A binding protein
SynonymsNS-1, Nd1-L, Nd1-S, 1700126I16Rik, 1190004M08Rik, ND1, HSPC068, NS1-BP
MMRRC Submission 038393-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.474) question?
Stock #R0107 (G1)
Quality Score225
Status Validated (trace)
Chromosomal Location151344477-151364422 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 151361570 bp
Amino Acid Change Asparagine to Isoleucine at position 495 (N495I)
Ref Sequence ENSEMBL: ENSMUSP00000095150 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023918] [ENSMUST00000097543] [ENSMUST00000111887] [ENSMUST00000186745] [ENSMUST00000190872]
Predicted Effect possibly damaging
Transcript: ENSMUST00000023918
AA Change: N537I

PolyPhen 2 Score 0.926 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000023918
Gene: ENSMUSG00000023150
AA Change: N537I

BTB 32 129 1.89e-25 SMART
BACK 134 233 3.39e-8 SMART
low complexity region 325 338 N/A INTRINSIC
Kelch 369 415 4.78e-15 SMART
Kelch 416 463 2.16e-13 SMART
Kelch 464 512 2.15e-8 SMART
Kelch 513 559 1.58e-15 SMART
Kelch 560 606 1.61e-12 SMART
Kelch 607 641 1.85e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000097543
AA Change: N495I

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000095150
Gene: ENSMUSG00000023150
AA Change: N495I

BTB 32 129 1.89e-25 SMART
Pfam:BACK 134 189 3.3e-8 PFAM
low complexity region 283 296 N/A INTRINSIC
Kelch 327 373 4.78e-15 SMART
Kelch 374 421 2.16e-13 SMART
Kelch 422 470 2.15e-8 SMART
Kelch 471 517 1.58e-15 SMART
Kelch 518 564 1.61e-12 SMART
Kelch 565 599 1.85e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111887
SMART Domains Protein: ENSMUSP00000107518
Gene: ENSMUSG00000023150

BTB 32 129 1.89e-25 SMART
BACK 134 219 7.04e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186745
SMART Domains Protein: ENSMUSP00000140708
Gene: ENSMUSG00000023150

BTB 32 129 1.89e-25 SMART
BACK 134 219 7.04e-6 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000190872
AA Change: N46I

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000140332
Gene: ENSMUSG00000023150
AA Change: N46I

Kelch 22 68 5.3e-18 SMART
Meta Mutation Damage Score 0.7971 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 90.6%
Validation Efficiency 99% (71/72)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit some early lethality, increased cellular sensitivity to cytochalasin and doxorubicin, and doxorubicin-induced cardiotoxicity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A G 4: 53,080,834 V825A probably benign Het
Adamts7 T C 9: 90,180,720 I409T possibly damaging Het
Adck1 T C 12: 88,446,656 W253R possibly damaging Het
Afg3l2 A G 18: 67,431,766 F213L probably damaging Het
Ankle2 T C 5: 110,253,027 V743A probably benign Het
Ankrd34c C T 9: 89,729,484 R268H probably benign Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
Ccdc7b T G 8: 129,178,197 probably benign Het
Cd320 A T 17: 33,848,085 M169L probably benign Het
Chn1 A G 2: 73,614,684 Y338H probably damaging Het
Chuk T A 19: 44,096,919 S263C probably damaging Het
Dennd4b C A 3: 90,272,736 P663T possibly damaging Het
Dnajc24 T G 2: 106,001,914 probably benign Het
Fam172a A G 13: 77,902,814 D145G probably damaging Het
Fbn2 A G 18: 58,056,203 V1617A probably benign Het
Fermt2 T C 14: 45,464,822 N502D probably damaging Het
Frrs1 A T 3: 116,896,716 I3F probably damaging Het
Fut1 C A 7: 45,618,846 Q20K possibly damaging Het
Gbf1 T C 19: 46,284,828 V1709A probably benign Het
Gfra3 G T 18: 34,711,306 H60Q probably benign Het
Gm10750 T A 2: 149,016,053 M93L unknown Het
Gm5538 T A 3: 59,752,316 L397I possibly damaging Het
Hmcn1 T A 1: 150,587,015 I5124L probably benign Het
Hps3 A C 3: 20,030,796 L76R probably damaging Het
Ifrd1 T A 12: 40,214,081 Q105L probably damaging Het
Irs2 A T 8: 11,004,691 V1247E probably damaging Het
Itgal T C 7: 127,328,559 probably benign Het
Kank1 T A 19: 25,430,366 probably benign Het
Mroh8 T C 2: 157,225,468 Q657R probably benign Het
Mthfd1l T C 10: 4,041,838 Y597H probably benign Het
Myom1 G A 17: 71,077,365 V692I probably damaging Het
Olfr347 T G 2: 36,734,718 Y132* probably null Het
Olfr45 A T 7: 140,691,345 M147L probably benign Het
Olfr835 A G 9: 19,035,333 D70G probably damaging Het
Palmd A T 3: 116,924,076 H257Q probably damaging Het
Pcnx2 A T 8: 125,753,586 V1994D probably benign Het
Phkb G A 8: 86,016,931 G553S probably benign Het
Plekha5 G A 6: 140,591,747 R646K possibly damaging Het
Ptprn A T 1: 75,255,712 L453M probably damaging Het
Ptprz1 T A 6: 23,000,570 D886E probably damaging Het
Rcn1 T A 2: 105,394,781 I110F possibly damaging Het
Scn1a T A 2: 66,324,633 T661S probably benign Het
Slc6a19 A G 13: 73,684,057 Y467H possibly damaging Het
Slc9c1 T A 16: 45,575,420 D611E probably benign Het
Slitrk6 T C 14: 110,751,963 E104G possibly damaging Het
Spag17 A T 3: 100,050,787 K920N possibly damaging Het
St3gal5 A G 6: 72,142,149 S82G probably benign Het
Tlk1 T C 2: 70,713,989 *767W probably null Het
Tln2 A G 9: 67,370,706 V342A probably damaging Het
Tmem104 T A 11: 115,202,180 M132K probably damaging Het
Tmem184c A G 8: 77,597,073 S387P possibly damaging Het
Tmtc1 A G 6: 148,425,913 V34A possibly damaging Het
Trim46 A G 3: 89,236,333 F596S probably damaging Het
Unc79 T A 12: 103,134,525 D1870E possibly damaging Het
Utp20 T C 10: 88,778,391 T1234A probably benign Het
Vmn1r31 T A 6: 58,472,743 T46S probably benign Het
Vps13a A T 19: 16,691,824 L1341Q probably benign Het
Wdr72 A T 9: 74,210,433 D821V probably damaging Het
Zfhx4 T C 3: 5,398,982 L1400P probably damaging Het
Zfp217 T A 2: 170,114,874 K735* probably null Het
Zfp235 A G 7: 24,137,116 Q29R probably damaging Het
Zfp628 A G 7: 4,920,168 Y463C probably damaging Het
Zkscan4 A G 13: 21,484,581 T401A possibly damaging Het
Other mutations in Ivns1abp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00225:Ivns1abp APN 1 151351112 splice site probably null
IGL01616:Ivns1abp APN 1 151361543 missense possibly damaging 0.69
IGL02061:Ivns1abp APN 1 151351573 missense probably damaging 0.97
IGL02630:Ivns1abp APN 1 151359635 missense probably damaging 1.00
H8562:Ivns1abp UTSW 1 151354695 missense probably damaging 0.98
PIT1430001:Ivns1abp UTSW 1 151361605 missense probably damaging 1.00
R0609:Ivns1abp UTSW 1 151360145 missense probably benign 0.02
R1104:Ivns1abp UTSW 1 151360109 missense probably benign 0.42
R1463:Ivns1abp UTSW 1 151361540 missense probably benign 0.05
R1512:Ivns1abp UTSW 1 151360936 missense possibly damaging 0.87
R1512:Ivns1abp UTSW 1 151360937 missense probably benign 0.02
R1521:Ivns1abp UTSW 1 151351558 missense probably damaging 1.00
R1550:Ivns1abp UTSW 1 151361491 missense probably damaging 1.00
R2047:Ivns1abp UTSW 1 151351631 missense possibly damaging 0.83
R2435:Ivns1abp UTSW 1 151363310 missense probably benign 0.04
R4471:Ivns1abp UTSW 1 151361239 missense probably benign 0.29
R5011:Ivns1abp UTSW 1 151363202 missense possibly damaging 0.76
R5667:Ivns1abp UTSW 1 151354009 missense probably benign 0.01
R5671:Ivns1abp UTSW 1 151354009 missense probably benign 0.01
R6505:Ivns1abp UTSW 1 151360993 missense probably benign 0.00
R8357:Ivns1abp UTSW 1 151354010 missense probably damaging 1.00
R8457:Ivns1abp UTSW 1 151354010 missense probably damaging 1.00
Z1176:Ivns1abp UTSW 1 151351033 missense probably damaging 0.99
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- gcctagaactttccatgtagcc -3'
Posted On2013-05-09