Incidental Mutation 'R0107:Olfr45'
ID33326
Institutional Source Beutler Lab
Gene Symbol Olfr45
Ensembl Gene ENSMUSG00000066122
Gene Nameolfactory receptor 45
SynonymsIB6, GA_x6K02T2PBJ9-42837030-42837962, MOR253-2
MMRRC Submission 038393-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R0107 (G1)
Quality Score225
Status Validated (trace)
Chromosome7
Chromosomal Location140681951-140696845 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 140691345 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 147 (M147L)
Ref Sequence ENSEMBL: ENSMUSP00000149309 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084454] [ENSMUST00000210241] [ENSMUST00000214637]
Predicted Effect probably benign
Transcript: ENSMUST00000084454
AA Change: M147L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000081492
Gene: ENSMUSG00000066122
AA Change: M147L

DomainStartEndE-ValueType
Pfam:7tm_4 32 308 2.8e-50 PFAM
Pfam:7TM_GPCR_Srsx 36 176 1.2e-7 PFAM
Pfam:7tm_1 42 291 3.7e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210241
AA Change: M147L
Predicted Effect probably benign
Transcript: ENSMUST00000214637
AA Change: M147L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 90.6%
Validation Efficiency 99% (71/72)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A G 4: 53,080,834 V825A probably benign Het
Adamts7 T C 9: 90,180,720 I409T possibly damaging Het
Adck1 T C 12: 88,446,656 W253R possibly damaging Het
Afg3l2 A G 18: 67,431,766 F213L probably damaging Het
Ankle2 T C 5: 110,253,027 V743A probably benign Het
Ankrd34c C T 9: 89,729,484 R268H probably benign Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
Ccdc7b T G 8: 129,178,197 probably benign Het
Cd320 A T 17: 33,848,085 M169L probably benign Het
Chn1 A G 2: 73,614,684 Y338H probably damaging Het
Chuk T A 19: 44,096,919 S263C probably damaging Het
Dennd4b C A 3: 90,272,736 P663T possibly damaging Het
Dnajc24 T G 2: 106,001,914 probably benign Het
Fam172a A G 13: 77,902,814 D145G probably damaging Het
Fbn2 A G 18: 58,056,203 V1617A probably benign Het
Fermt2 T C 14: 45,464,822 N502D probably damaging Het
Frrs1 A T 3: 116,896,716 I3F probably damaging Het
Fut1 C A 7: 45,618,846 Q20K possibly damaging Het
Gbf1 T C 19: 46,284,828 V1709A probably benign Het
Gfra3 G T 18: 34,711,306 H60Q probably benign Het
Gm10750 T A 2: 149,016,053 M93L unknown Het
Gm5538 T A 3: 59,752,316 L397I possibly damaging Het
Hmcn1 T A 1: 150,587,015 I5124L probably benign Het
Hps3 A C 3: 20,030,796 L76R probably damaging Het
Ifrd1 T A 12: 40,214,081 Q105L probably damaging Het
Irs2 A T 8: 11,004,691 V1247E probably damaging Het
Itgal T C 7: 127,328,559 probably benign Het
Ivns1abp A T 1: 151,361,570 N495I probably damaging Het
Kank1 T A 19: 25,430,366 probably benign Het
Mroh8 T C 2: 157,225,468 Q657R probably benign Het
Mthfd1l T C 10: 4,041,838 Y597H probably benign Het
Myom1 G A 17: 71,077,365 V692I probably damaging Het
Olfr347 T G 2: 36,734,718 Y132* probably null Het
Olfr835 A G 9: 19,035,333 D70G probably damaging Het
Palmd A T 3: 116,924,076 H257Q probably damaging Het
Pcnx2 A T 8: 125,753,586 V1994D probably benign Het
Phkb G A 8: 86,016,931 G553S probably benign Het
Plekha5 G A 6: 140,591,747 R646K possibly damaging Het
Ptprn A T 1: 75,255,712 L453M probably damaging Het
Ptprz1 T A 6: 23,000,570 D886E probably damaging Het
Rcn1 T A 2: 105,394,781 I110F possibly damaging Het
Scn1a T A 2: 66,324,633 T661S probably benign Het
Slc6a19 A G 13: 73,684,057 Y467H possibly damaging Het
Slc9c1 T A 16: 45,575,420 D611E probably benign Het
Slitrk6 T C 14: 110,751,963 E104G possibly damaging Het
Spag17 A T 3: 100,050,787 K920N possibly damaging Het
St3gal5 A G 6: 72,142,149 S82G probably benign Het
Tlk1 T C 2: 70,713,989 *767W probably null Het
Tln2 A G 9: 67,370,706 V342A probably damaging Het
Tmem104 T A 11: 115,202,180 M132K probably damaging Het
Tmem184c A G 8: 77,597,073 S387P possibly damaging Het
Tmtc1 A G 6: 148,425,913 V34A possibly damaging Het
Trim46 A G 3: 89,236,333 F596S probably damaging Het
Unc79 T A 12: 103,134,525 D1870E possibly damaging Het
Utp20 T C 10: 88,778,391 T1234A probably benign Het
Vmn1r31 T A 6: 58,472,743 T46S probably benign Het
Vps13a A T 19: 16,691,824 L1341Q probably benign Het
Wdr72 A T 9: 74,210,433 D821V probably damaging Het
Zfhx4 T C 3: 5,398,982 L1400P probably damaging Het
Zfp217 T A 2: 170,114,874 K735* probably null Het
Zfp235 A G 7: 24,137,116 Q29R probably damaging Het
Zfp628 A G 7: 4,920,168 Y463C probably damaging Het
Zkscan4 A G 13: 21,484,581 T401A possibly damaging Het
Other mutations in Olfr45
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Olfr45 APN 7 140691436 missense probably damaging 1.00
IGL01434:Olfr45 APN 7 140691618 missense probably damaging 1.00
IGL01697:Olfr45 APN 7 140691652 missense possibly damaging 0.61
IGL02167:Olfr45 APN 7 140691751 missense probably damaging 0.98
IGL02388:Olfr45 APN 7 140691111 missense probably benign 0.00
IGL03054:Olfr45 UTSW 7 140691710 missense probably benign 0.10
R0403:Olfr45 UTSW 7 140691309 missense possibly damaging 0.80
R1344:Olfr45 UTSW 7 140691799 missense probably damaging 0.98
R1859:Olfr45 UTSW 7 140691658 missense possibly damaging 0.80
R2871:Olfr45 UTSW 7 140691285 missense possibly damaging 0.95
R2871:Olfr45 UTSW 7 140691285 missense possibly damaging 0.95
R3611:Olfr45 UTSW 7 140691100 missense probably benign 0.01
R3915:Olfr45 UTSW 7 140690975 missense probably benign
R4551:Olfr45 UTSW 7 140691742 missense probably damaging 1.00
R4552:Olfr45 UTSW 7 140691742 missense probably damaging 1.00
R4627:Olfr45 UTSW 7 140691378 missense probably benign 0.00
R4628:Olfr45 UTSW 7 140691378 missense probably benign 0.00
R4629:Olfr45 UTSW 7 140691378 missense probably benign 0.00
R4990:Olfr45 UTSW 7 140691447 missense probably damaging 0.99
R5503:Olfr45 UTSW 7 140691396 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GAAAGACATAGCAGTGGACCCCATC -3'
(R):5'- GGTAAGCACAAAATTGACGCCTCC -3'

Sequencing Primer
(F):5'- GGGCAACATTTTGATCATCGC -3'
(R):5'- ATTGACGCCTCCAAAAAAGG -3'
Posted On2013-05-09