Incidental Mutation 'R0064:Cstf2t'
ID34436
Institutional Source Beutler Lab
Gene Symbol Cstf2t
Ensembl Gene ENSMUSG00000053536
Gene Namecleavage stimulation factor, 3' pre-RNA subunit 2, tau
Synonyms64kDa, tCstF-64
MMRRC Submission 038356-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.199) question?
Stock #R0064 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location31082841-31086590 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 31083299 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 78 (N78K)
Ref Sequence ENSEMBL: ENSMUSP00000093831 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065067] [ENSMUST00000066039] [ENSMUST00000073581]
Predicted Effect probably benign
Transcript: ENSMUST00000065067
SMART Domains Protein: ENSMUSP00000067576
Gene: ENSMUSG00000052920

DomainStartEndE-ValueType
coiled coil region 5 49 N/A INTRINSIC
cNMP 103 216 6.37e-27 SMART
cNMP 221 343 1.23e-33 SMART
S_TKc 360 619 5.25e-91 SMART
S_TK_X 620 671 1.55e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000066039
AA Change: N78K

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000093831
Gene: ENSMUSG00000053536
AA Change: N78K

DomainStartEndE-ValueType
RRM 17 90 6.19e-29 SMART
Pfam:CSTF2_hinge 112 191 5.4e-32 PFAM
low complexity region 202 236 N/A INTRINSIC
low complexity region 240 257 N/A INTRINSIC
low complexity region 271 295 N/A INTRINSIC
low complexity region 297 310 N/A INTRINSIC
low complexity region 321 339 N/A INTRINSIC
low complexity region 364 379 N/A INTRINSIC
low complexity region 508 584 N/A INTRINSIC
Pfam:CSTF_C 588 628 7.2e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000073581
SMART Domains Protein: ENSMUSP00000073268
Gene: ENSMUSG00000052920

DomainStartEndE-ValueType
coiled coil region 10 62 N/A INTRINSIC
cNMP 118 231 6.37e-27 SMART
cNMP 236 358 1.23e-33 SMART
S_TKc 375 634 5.25e-91 SMART
S_TK_X 635 686 1.55e-10 SMART
Meta Mutation Damage Score 0.6899 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 100% (55/55)
MGI Phenotype PHENOTYPE: Male mice homozygous for a targeted null allele are infertile due to low sperm counts, significant developmental defects in spermiogenesis, and variable abnormalities in epididymal sperm morphology and motility consistent with oligoasthenoteratozoospermia. Homozygous null females are fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 A C 11: 110,144,871 L641R probably damaging Het
Abca9 G T 11: 110,144,872 L641M probably damaging Het
Abhd18 A G 3: 40,933,853 I377M probably benign Het
Arhgef17 C A 7: 100,881,354 M1408I probably benign Het
Bcl2a1a G C 9: 88,957,463 G138A probably damaging Het
C4b A G 17: 34,738,856 L617P probably damaging Het
Ccdc25 T A 14: 65,854,112 I60K possibly damaging Het
Cdk1 T C 10: 69,345,077 D101G probably benign Het
Cdon A G 9: 35,489,227 H1079R probably benign Het
Cep126 A T 9: 8,130,182 probably benign Het
Cic T A 7: 25,287,140 S1299T probably damaging Het
Cic C A 7: 25,287,141 S1299Y probably damaging Het
Clstn1 G A 4: 149,634,796 V361M probably damaging Het
Crlf3 A G 11: 80,057,902 I239T possibly damaging Het
Cul1 A G 6: 47,502,415 probably benign Het
D430041D05Rik T G 2: 104,249,157 T1194P probably damaging Het
Fbp2 A T 13: 62,854,048 F118I probably damaging Het
Fbxw14 A T 9: 109,287,592 Y16* probably null Het
Fgd3 T G 13: 49,296,425 D116A possibly damaging Het
Gm7168 C T 17: 13,949,859 T496I probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Klhl5 T A 5: 65,141,288 S137T probably benign Het
Knl1 T A 2: 119,076,243 N1604K probably benign Het
Lpcat1 T A 13: 73,514,466 N463K probably damaging Het
Lpl A G 8: 68,892,704 H120R probably damaging Het
Man1a2 A T 3: 100,591,883 S412T possibly damaging Het
Mcc C G 18: 44,519,516 probably benign Het
Myo18a G T 11: 77,847,344 R1704L probably damaging Het
Nlrc3 G T 16: 3,964,087 T486K possibly damaging Het
Nrip1 T A 16: 76,294,670 probably benign Het
Nutf2 A G 8: 105,878,809 D92G probably damaging Het
Obscn A C 11: 59,027,466 V6260G probably damaging Het
Olfr320 G A 11: 58,684,475 V201M probably benign Het
Olfr714 T C 7: 107,074,280 F151L probably benign Het
Plce1 T C 19: 38,780,784 probably null Het
Pmpca C A 2: 26,395,507 D498E probably benign Het
Pnpla7 G T 2: 24,997,227 E28* probably null Het
Polg C A 7: 79,461,884 W206C probably damaging Het
Ptprt C T 2: 161,927,791 probably benign Het
Slc7a14 T C 3: 31,227,060 D367G probably damaging Het
Spata31 T C 13: 64,922,098 Y687H probably damaging Het
Sybu T A 15: 44,672,993 T646S probably benign Het
Thbs1 A T 2: 118,123,914 probably null Het
Tie1 A G 4: 118,489,701 V2A possibly damaging Het
Tma16 A T 8: 66,476,805 I179K possibly damaging Het
Tns3 G A 11: 8,435,856 Q1381* probably null Het
Trank1 A G 9: 111,343,195 D84G probably damaging Het
Ttc3 A T 16: 94,422,247 H197L possibly damaging Het
Urb1 A G 16: 90,779,140 F843L probably benign Het
Vmn1r24 T G 6: 57,956,018 I172L probably benign Het
Vmn2r1 T A 3: 64,104,788 I690N possibly damaging Het
Vmn2r111 T A 17: 22,572,072 I82L probably benign Het
Zfp287 A T 11: 62,714,938 L370H possibly damaging Het
Zfp608 A T 18: 54,898,816 I684N probably benign Het
Other mutations in Cstf2t
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01731:Cstf2t APN 19 31084338 missense probably benign 0.00
IGL01739:Cstf2t APN 19 31083136 missense probably damaging 1.00
IGL02466:Cstf2t APN 19 31083877 missense possibly damaging 0.88
R0099:Cstf2t UTSW 19 31083831 missense probably benign 0.00
R0197:Cstf2t UTSW 19 31084626 missense probably benign 0.01
R0423:Cstf2t UTSW 19 31084276 missense possibly damaging 0.89
R0883:Cstf2t UTSW 19 31084626 missense probably benign 0.01
R1753:Cstf2t UTSW 19 31083685 missense possibly damaging 0.52
R2206:Cstf2t UTSW 19 31083775 missense probably benign 0.00
R2291:Cstf2t UTSW 19 31084864 missense probably benign 0.36
R3753:Cstf2t UTSW 19 31083295 missense probably damaging 1.00
R4523:Cstf2t UTSW 19 31083082 missense possibly damaging 0.47
R4991:Cstf2t UTSW 19 31084583 missense probably damaging 0.97
R5134:Cstf2t UTSW 19 31084094 missense probably damaging 1.00
R5863:Cstf2t UTSW 19 31083077 missense probably damaging 1.00
R6081:Cstf2t UTSW 19 31083123 missense probably benign 0.10
R6573:Cstf2t UTSW 19 31083780 missense probably benign 0.00
R7408:Cstf2t UTSW 19 31083193 missense possibly damaging 0.94
R7648:Cstf2t UTSW 19 31083592 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- AGACGAATTCAATCTCCGCTGTCC -3'
(R):5'- CAAGCTGGCGACTGCTCTAGTAATC -3'

Sequencing Primer
(F):5'- CGGCAGCAATCATGTCGAG -3'
(R):5'- ATCGATTCTGGAGCATCTTCTG -3'
Posted On2013-05-09