Incidental Mutation 'R0064:Cul1'
ID34397
Institutional Source Beutler Lab
Gene Symbol Cul1
Ensembl Gene ENSMUSG00000029686
Gene Namecullin 1
Synonyms
MMRRC Submission 038356-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0064 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location47453398-47526139 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 47502415 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000122702 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031697] [ENSMUST00000146200]
Predicted Effect probably benign
Transcript: ENSMUST00000031697
SMART Domains Protein: ENSMUSP00000031697
Gene: ENSMUSG00000029686

DomainStartEndE-ValueType
SCOP:d1ldja2 17 410 1e-174 SMART
CULLIN 447 594 3.69e-81 SMART
low complexity region 638 651 N/A INTRINSIC
Cullin_Nedd8 703 770 6.19e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146200
SMART Domains Protein: ENSMUSP00000122702
Gene: ENSMUSG00000029686

DomainStartEndE-ValueType
SCOP:d1ldja2 17 410 1e-176 SMART
CULLIN 447 594 3.69e-81 SMART
low complexity region 638 651 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 100% (55/55)
MGI Phenotype PHENOTYPE: Homozygotes for targeted null mutations accumulate cyclin E1 and exhibit arrested development and lethality around embryonic day 6.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 A C 11: 110,144,871 L641R probably damaging Het
Abca9 G T 11: 110,144,872 L641M probably damaging Het
Abhd18 A G 3: 40,933,853 I377M probably benign Het
Arhgef17 C A 7: 100,881,354 M1408I probably benign Het
Bcl2a1a G C 9: 88,957,463 G138A probably damaging Het
C4b A G 17: 34,738,856 L617P probably damaging Het
Ccdc25 T A 14: 65,854,112 I60K possibly damaging Het
Cdk1 T C 10: 69,345,077 D101G probably benign Het
Cdon A G 9: 35,489,227 H1079R probably benign Het
Cep126 A T 9: 8,130,182 probably benign Het
Cic T A 7: 25,287,140 S1299T probably damaging Het
Cic C A 7: 25,287,141 S1299Y probably damaging Het
Clstn1 G A 4: 149,634,796 V361M probably damaging Het
Crlf3 A G 11: 80,057,902 I239T possibly damaging Het
Cstf2t T A 19: 31,083,299 N78K probably damaging Het
D430041D05Rik T G 2: 104,249,157 T1194P probably damaging Het
Fbp2 A T 13: 62,854,048 F118I probably damaging Het
Fbxw14 A T 9: 109,287,592 Y16* probably null Het
Fgd3 T G 13: 49,296,425 D116A possibly damaging Het
Gm7168 C T 17: 13,949,859 T496I probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Klhl5 T A 5: 65,141,288 S137T probably benign Het
Knl1 T A 2: 119,076,243 N1604K probably benign Het
Lpcat1 T A 13: 73,514,466 N463K probably damaging Het
Lpl A G 8: 68,892,704 H120R probably damaging Het
Man1a2 A T 3: 100,591,883 S412T possibly damaging Het
Mcc C G 18: 44,519,516 probably benign Het
Myo18a G T 11: 77,847,344 R1704L probably damaging Het
Nlrc3 G T 16: 3,964,087 T486K possibly damaging Het
Nrip1 T A 16: 76,294,670 probably benign Het
Nutf2 A G 8: 105,878,809 D92G probably damaging Het
Obscn A C 11: 59,027,466 V6260G probably damaging Het
Olfr320 G A 11: 58,684,475 V201M probably benign Het
Olfr714 T C 7: 107,074,280 F151L probably benign Het
Plce1 T C 19: 38,780,784 probably null Het
Pmpca C A 2: 26,395,507 D498E probably benign Het
Pnpla7 G T 2: 24,997,227 E28* probably null Het
Polg C A 7: 79,461,884 W206C probably damaging Het
Ptprt C T 2: 161,927,791 probably benign Het
Slc7a14 T C 3: 31,227,060 D367G probably damaging Het
Spata31 T C 13: 64,922,098 Y687H probably damaging Het
Sybu T A 15: 44,672,993 T646S probably benign Het
Thbs1 A T 2: 118,123,914 probably null Het
Tie1 A G 4: 118,489,701 V2A possibly damaging Het
Tma16 A T 8: 66,476,805 I179K possibly damaging Het
Tns3 G A 11: 8,435,856 Q1381* probably null Het
Trank1 A G 9: 111,343,195 D84G probably damaging Het
Ttc3 A T 16: 94,422,247 H197L possibly damaging Het
Urb1 A G 16: 90,779,140 F843L probably benign Het
Vmn1r24 T G 6: 57,956,018 I172L probably benign Het
Vmn2r1 T A 3: 64,104,788 I690N possibly damaging Het
Vmn2r111 T A 17: 22,572,072 I82L probably benign Het
Zfp287 A T 11: 62,714,938 L370H possibly damaging Het
Zfp608 A T 18: 54,898,816 I684N probably benign Het
Other mutations in Cul1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01087:Cul1 APN 6 47509044 missense probably benign
IGL02410:Cul1 APN 6 47485014 missense probably damaging 1.00
IGL02458:Cul1 APN 6 47525608 missense possibly damaging 0.91
IGL02490:Cul1 APN 6 47514886 missense probably damaging 0.98
IGL03065:Cul1 APN 6 47495081 missense probably damaging 1.00
IGL03387:Cul1 APN 6 47501209 missense probably damaging 0.96
IGL02837:Cul1 UTSW 6 47523205 missense probably benign 0.01
R0064:Cul1 UTSW 6 47502415 splice site probably benign
R0436:Cul1 UTSW 6 47523773 missense probably benign 0.16
R0746:Cul1 UTSW 6 47518288 splice site probably null
R1103:Cul1 UTSW 6 47517177 missense probably benign 0.03
R1471:Cul1 UTSW 6 47514886 missense probably damaging 0.98
R1746:Cul1 UTSW 6 47508245 missense probably damaging 0.98
R1852:Cul1 UTSW 6 47520830 missense probably damaging 0.99
R1858:Cul1 UTSW 6 47525524 intron probably null
R1937:Cul1 UTSW 6 47508355 missense probably benign 0.19
R1964:Cul1 UTSW 6 47502571 missense probably damaging 0.98
R2985:Cul1 UTSW 6 47502507 missense probably damaging 1.00
R4452:Cul1 UTSW 6 47508989 nonsense probably null
R4653:Cul1 UTSW 6 47484963 missense probably damaging 1.00
R4860:Cul1 UTSW 6 47517146 missense probably benign 0.38
R4860:Cul1 UTSW 6 47517191 missense probably damaging 0.99
R4860:Cul1 UTSW 6 47517146 missense probably benign 0.38
R4860:Cul1 UTSW 6 47517191 missense probably damaging 0.99
R5141:Cul1 UTSW 6 47520839 missense probably benign 0.04
R5328:Cul1 UTSW 6 47508317 missense probably damaging 0.99
R5399:Cul1 UTSW 6 47485084 unclassified probably null
R5593:Cul1 UTSW 6 47485086 nonsense probably null
R5593:Cul1 UTSW 6 47514991 missense probably damaging 0.99
R5616:Cul1 UTSW 6 47523788 missense probably damaging 1.00
R5855:Cul1 UTSW 6 47523213 missense probably benign 0.00
R6382:Cul1 UTSW 6 47502439 missense probably damaging 1.00
R6670:Cul1 UTSW 6 47517134 missense probably damaging 1.00
R6964:Cul1 UTSW 6 47516509 missense probably benign 0.01
RF001:Cul1 UTSW 6 47524581 missense possibly damaging 0.50
RF055:Cul1 UTSW 6 47517133 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAAGTGTTCCTGGCACAAGTAAGG -3'
(R):5'- TGACAGCAGTGACAAGCCTGAC -3'

Sequencing Primer
(F):5'- GGCACAAGTAAGGATTATTTGCTG -3'
(R):5'- TGACAAGCCTGACTGGTG -3'
Posted On2013-05-09