Incidental Mutation 'R0064:Clstn1'
ID34395
Institutional Source Beutler Lab
Gene Symbol Clstn1
Ensembl Gene ENSMUSG00000039953
Gene Namecalsyntenin 1
SynonymsCst-1, calsyntenin-1, 1810034E21Rik, alcadein alpha
MMRRC Submission 038356-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0064 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location149586468-149648899 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 149634796 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 361 (V361M)
Ref Sequence ENSEMBL: ENSMUSP00000101316 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039144] [ENSMUST00000105691]
Predicted Effect possibly damaging
Transcript: ENSMUST00000039144
AA Change: V371M

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000036962
Gene: ENSMUSG00000039953
AA Change: V371M

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 59 162 1.25e-11 SMART
CA 185 263 1.03e-3 SMART
Pfam:Laminin_G_3 365 510 3.3e-9 PFAM
low complexity region 663 674 N/A INTRINSIC
transmembrane domain 860 882 N/A INTRINSIC
coiled coil region 915 949 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105691
AA Change: V361M

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000101316
Gene: ENSMUSG00000039953
AA Change: V361M

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 59 152 2.91e-12 SMART
CA 175 253 1.03e-3 SMART
Pfam:Laminin_G_3 350 544 1.1e-12 PFAM
low complexity region 653 664 N/A INTRINSIC
transmembrane domain 850 872 N/A INTRINSIC
coiled coil region 905 939 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151895
Meta Mutation Damage Score 0.2773 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the calsyntenin family, a subset of the cadherin superfamily. The encoded transmembrane protein, also known as alcadein-alpha, is thought to bind to kinesin-1 motors to mediate the axonal anterograde transport of certain types of vesicle. Amyloid precursor protein (APP) is trafficked via these vesicles and so this protein is being investigated to see how it might contribute to the mechanisms underlying Alzheimer's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
PHENOTYPE: Juvenile mice homozygous for a null allele show reduced basal excitatory synaptic transmission, abnormal excitatory postsynaptic currents, enhanced NMDA receptor-dependent long term potentiation, and delayed dendritic spine maturation in CA1 hippocampal pyramidal cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 A C 11: 110,144,871 L641R probably damaging Het
Abca9 G T 11: 110,144,872 L641M probably damaging Het
Abhd18 A G 3: 40,933,853 I377M probably benign Het
Arhgef17 C A 7: 100,881,354 M1408I probably benign Het
Bcl2a1a G C 9: 88,957,463 G138A probably damaging Het
C4b A G 17: 34,738,856 L617P probably damaging Het
Ccdc25 T A 14: 65,854,112 I60K possibly damaging Het
Cdk1 T C 10: 69,345,077 D101G probably benign Het
Cdon A G 9: 35,489,227 H1079R probably benign Het
Cep126 A T 9: 8,130,182 probably benign Het
Cic T A 7: 25,287,140 S1299T probably damaging Het
Cic C A 7: 25,287,141 S1299Y probably damaging Het
Crlf3 A G 11: 80,057,902 I239T possibly damaging Het
Cstf2t T A 19: 31,083,299 N78K probably damaging Het
Cul1 A G 6: 47,502,415 probably benign Het
D430041D05Rik T G 2: 104,249,157 T1194P probably damaging Het
Fbp2 A T 13: 62,854,048 F118I probably damaging Het
Fbxw14 A T 9: 109,287,592 Y16* probably null Het
Fgd3 T G 13: 49,296,425 D116A possibly damaging Het
Gm7168 C T 17: 13,949,859 T496I probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Klhl5 T A 5: 65,141,288 S137T probably benign Het
Knl1 T A 2: 119,076,243 N1604K probably benign Het
Lpcat1 T A 13: 73,514,466 N463K probably damaging Het
Lpl A G 8: 68,892,704 H120R probably damaging Het
Man1a2 A T 3: 100,591,883 S412T possibly damaging Het
Mcc C G 18: 44,519,516 probably benign Het
Myo18a G T 11: 77,847,344 R1704L probably damaging Het
Nlrc3 G T 16: 3,964,087 T486K possibly damaging Het
Nrip1 T A 16: 76,294,670 probably benign Het
Nutf2 A G 8: 105,878,809 D92G probably damaging Het
Obscn A C 11: 59,027,466 V6260G probably damaging Het
Olfr320 G A 11: 58,684,475 V201M probably benign Het
Olfr714 T C 7: 107,074,280 F151L probably benign Het
Plce1 T C 19: 38,780,784 probably null Het
Pmpca C A 2: 26,395,507 D498E probably benign Het
Pnpla7 G T 2: 24,997,227 E28* probably null Het
Polg C A 7: 79,461,884 W206C probably damaging Het
Ptprt C T 2: 161,927,791 probably benign Het
Slc7a14 T C 3: 31,227,060 D367G probably damaging Het
Spata31 T C 13: 64,922,098 Y687H probably damaging Het
Sybu T A 15: 44,672,993 T646S probably benign Het
Thbs1 A T 2: 118,123,914 probably null Het
Tie1 A G 4: 118,489,701 V2A possibly damaging Het
Tma16 A T 8: 66,476,805 I179K possibly damaging Het
Tns3 G A 11: 8,435,856 Q1381* probably null Het
Trank1 A G 9: 111,343,195 D84G probably damaging Het
Ttc3 A T 16: 94,422,247 H197L possibly damaging Het
Urb1 A G 16: 90,779,140 F843L probably benign Het
Vmn1r24 T G 6: 57,956,018 I172L probably benign Het
Vmn2r1 T A 3: 64,104,788 I690N possibly damaging Het
Vmn2r111 T A 17: 22,572,072 I82L probably benign Het
Zfp287 A T 11: 62,714,938 L370H possibly damaging Het
Zfp608 A T 18: 54,898,816 I684N probably benign Het
Other mutations in Clstn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00486:Clstn1 APN 4 149635243 missense probably damaging 0.99
IGL00585:Clstn1 APN 4 149638312 missense probably benign 0.05
IGL00911:Clstn1 APN 4 149643191 splice site probably benign
IGL01394:Clstn1 APN 4 149634782 missense possibly damaging 0.87
IGL02193:Clstn1 APN 4 149645352 missense probably benign 0.03
IGL02406:Clstn1 APN 4 149627359 missense probably damaging 1.00
IGL02501:Clstn1 APN 4 149631842 missense probably damaging 1.00
IGL02641:Clstn1 APN 4 149629511 missense probably null 1.00
R0012:Clstn1 UTSW 4 149634796 missense probably damaging 0.96
R0020:Clstn1 UTSW 4 149634796 missense probably damaging 0.96
R0021:Clstn1 UTSW 4 149634796 missense probably damaging 0.96
R0026:Clstn1 UTSW 4 149634796 missense probably damaging 0.96
R0031:Clstn1 UTSW 4 149634796 missense probably damaging 0.96
R0038:Clstn1 UTSW 4 149634796 missense probably damaging 0.96
R0062:Clstn1 UTSW 4 149634796 missense probably damaging 0.96
R0193:Clstn1 UTSW 4 149634796 missense probably damaging 0.96
R0279:Clstn1 UTSW 4 149643674 missense probably damaging 1.00
R0394:Clstn1 UTSW 4 149644178 missense probably benign 0.00
R0609:Clstn1 UTSW 4 149629300 splice site probably null
R0685:Clstn1 UTSW 4 149646855 missense probably benign 0.24
R0724:Clstn1 UTSW 4 149643624 missense possibly damaging 0.84
R1016:Clstn1 UTSW 4 149646829 missense probably benign 0.21
R1470:Clstn1 UTSW 4 149634722 missense possibly damaging 0.94
R1470:Clstn1 UTSW 4 149634722 missense possibly damaging 0.94
R1622:Clstn1 UTSW 4 149629407 missense probably damaging 0.97
R1680:Clstn1 UTSW 4 149643726 missense probably benign 0.02
R3803:Clstn1 UTSW 4 149635339 missense probably damaging 0.99
R3836:Clstn1 UTSW 4 149638333 missense probably damaging 1.00
R3838:Clstn1 UTSW 4 149638333 missense probably damaging 1.00
R4923:Clstn1 UTSW 4 149645029 missense probably benign 0.07
R5024:Clstn1 UTSW 4 149635294 missense possibly damaging 0.91
R5919:Clstn1 UTSW 4 149635246 missense probably damaging 1.00
R6269:Clstn1 UTSW 4 149644067 missense probably benign 0.00
R6354:Clstn1 UTSW 4 149643216 missense probably benign 0.05
R6382:Clstn1 UTSW 4 149626120 unclassified probably null
R6573:Clstn1 UTSW 4 149643689 missense probably damaging 1.00
R7342:Clstn1 UTSW 4 149629430 missense probably damaging 0.98
R7457:Clstn1 UTSW 4 149634916 missense probably benign 0.03
R7571:Clstn1 UTSW 4 149646287 missense probably benign 0.38
R7682:Clstn1 UTSW 4 149626101 missense possibly damaging 0.72
R7738:Clstn1 UTSW 4 149635354 missense probably damaging 1.00
R7803:Clstn1 UTSW 4 149631871 missense probably damaging 1.00
R7904:Clstn1 UTSW 4 149614137 missense probably benign 0.01
R7987:Clstn1 UTSW 4 149614137 missense probably benign 0.01
R8007:Clstn1 UTSW 4 149631848 missense probably damaging 1.00
X0020:Clstn1 UTSW 4 149635251 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAACCCCTTAGTGAGGCACTGAAC -3'
(R):5'- GTGTCCCCAGCATAGAACGAAGAG -3'

Sequencing Primer
(F):5'- TTAGTGAGGCACTGAACCACTC -3'
(R):5'- ACCCAGTCCCTGTGAGGAG -3'
Posted On2013-05-09