Mutagenetix > Incidental Mutation

Incidental Mutation 'R0064:Clstn1'

34395

Institutional Source

Beutler Lab

Gene Symbol

Clstn1

Ensembl Gene

ENSMUSG00000039953

Gene Name

calsyntenin 1

Synonyms

Cst-1, calsyntenin-1, 1810034E21Rik, alcadein alpha

MMRRC Submission

038356-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0064 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

149586468-149648899 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 149634796 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 361 (V361M)

Ref Sequence

ENSEMBL: ENSMUSP00000101316 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039144] [ENSMUST00000105691]

AlphaFold

Q9EPL2

Predicted Effect

possibly damaging
Transcript: ENSMUST00000039144
AA Change: V371M

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000036962
Gene: ENSMUSG00000039953
AA Change: V371M

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
CA	59	162	1.25e-11	SMART
CA	185	263	1.03e-3	SMART
Pfam:Laminin_G_3	365	510	3.3e-9	PFAM
low complexity region	663	674	N/A	INTRINSIC
transmembrane domain	860	882	N/A	INTRINSIC
coiled coil region	915	949	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000105691
AA Change: V361M

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000101316
Gene: ENSMUSG00000039953
AA Change: V361M

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
CA	59	152	2.91e-12	SMART
CA	175	253	1.03e-3	SMART
Pfam:Laminin_G_3	350	544	1.1e-12	PFAM
low complexity region	653	664	N/A	INTRINSIC
transmembrane domain	850	872	N/A	INTRINSIC
coiled coil region	905	939	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151895

Meta Mutation Damage Score

0.2773

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.1%
20x: 95.0%

Validation Efficiency

100% (55/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the calsyntenin family, a subset of the cadherin superfamily. The encoded transmembrane protein, also known as alcadein-alpha, is thought to bind to kinesin-1 motors to mediate the axonal anterograde transport of certain types of vesicle. Amyloid precursor protein (APP) is trafficked via these vesicles and so this protein is being investigated to see how it might contribute to the mechanisms underlying Alzheimer's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
PHENOTYPE: Juvenile mice homozygous for a null allele show reduced basal excitatory synaptic transmission, abnormal excitatory postsynaptic currents, enhanced NMDA receptor-dependent long term potentiation, and delayed dendritic spine maturation in CA1 hippocampal pyramidal cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca9	A	C	11: 110,144,871	L641R	probably damaging	Het
Abca9	G	T	11: 110,144,872	L641M	probably damaging	Het
Abhd18	A	G	3: 40,933,853	I377M	probably benign	Het
Arhgef17	C	A	7: 100,881,354	M1408I	probably benign	Het
Bcl2a1a	G	C	9: 88,957,463	G138A	probably damaging	Het
C4b	A	G	17: 34,738,856	L617P	probably damaging	Het
Ccdc25	T	A	14: 65,854,112	I60K	possibly damaging	Het
Cdk1	T	C	10: 69,345,077	D101G	probably benign	Het
Cdon	A	G	9: 35,489,227	H1079R	probably benign	Het
Cep126	A	T	9: 8,130,182		probably benign	Het
Cic	T	A	7: 25,287,140	S1299T	probably damaging	Het
Cic	C	A	7: 25,287,141	S1299Y	probably damaging	Het
Crlf3	A	G	11: 80,057,902	I239T	possibly damaging	Het
Cstf2t	T	A	19: 31,083,299	N78K	probably damaging	Het
Cul1	A	G	6: 47,502,415		probably benign	Het
D430041D05Rik	T	G	2: 104,249,157	T1194P	probably damaging	Het
Fbp2	A	T	13: 62,854,048	F118I	probably damaging	Het
Fbxw14	A	T	9: 109,287,592	Y16*	probably null	Het
Fgd3	T	G	13: 49,296,425	D116A	possibly damaging	Het
Gm7168	C	T	17: 13,949,859	T496I	probably benign	Het
Hsh2d	G	A	8: 72,200,460	D229N	probably benign	Het
Klhl5	T	A	5: 65,141,288	S137T	probably benign	Het
Knl1	T	A	2: 119,076,243	N1604K	probably benign	Het
Lpcat1	T	A	13: 73,514,466	N463K	probably damaging	Het
Lpl	A	G	8: 68,892,704	H120R	probably damaging	Het
Man1a2	A	T	3: 100,591,883	S412T	possibly damaging	Het
Mcc	C	G	18: 44,519,516		probably benign	Het
Myo18a	G	T	11: 77,847,344	R1704L	probably damaging	Het
Nlrc3	G	T	16: 3,964,087	T486K	possibly damaging	Het
Nrip1	T	A	16: 76,294,670		probably benign	Het
Nutf2	A	G	8: 105,878,809	D92G	probably damaging	Het
Obscn	A	C	11: 59,027,466	V6260G	probably damaging	Het
Olfr320	G	A	11: 58,684,475	V201M	probably benign	Het
Olfr714	T	C	7: 107,074,280	F151L	probably benign	Het
Plce1	T	C	19: 38,780,784		probably null	Het
Pmpca	C	A	2: 26,395,507	D498E	probably benign	Het
Pnpla7	G	T	2: 24,997,227	E28*	probably null	Het
Polg	C	A	7: 79,461,884	W206C	probably damaging	Het
Ptprt	C	T	2: 161,927,791		probably benign	Het
Slc7a14	T	C	3: 31,227,060	D367G	probably damaging	Het
Spata31	T	C	13: 64,922,098	Y687H	probably damaging	Het
Sybu	T	A	15: 44,672,993	T646S	probably benign	Het
Thbs1	A	T	2: 118,123,914		probably null	Het
Tie1	A	G	4: 118,489,701	V2A	possibly damaging	Het
Tma16	A	T	8: 66,476,805	I179K	possibly damaging	Het
Tns3	G	A	11: 8,435,856	Q1381*	probably null	Het
Trank1	A	G	9: 111,343,195	D84G	probably damaging	Het
Ttc3	A	T	16: 94,422,247	H197L	possibly damaging	Het
Urb1	A	G	16: 90,779,140	F843L	probably benign	Het
Vmn1r24	T	G	6: 57,956,018	I172L	probably benign	Het
Vmn2r1	T	A	3: 64,104,788	I690N	possibly damaging	Het
Vmn2r111	T	A	17: 22,572,072	I82L	probably benign	Het
Zfp287	A	T	11: 62,714,938	L370H	possibly damaging	Het
Zfp608	A	T	18: 54,898,816	I684N	probably benign	Het

Other mutations in Clstn1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00486:Clstn1	APN	4	149635243	missense	probably damaging	0.99
IGL00585:Clstn1	APN	4	149638312	missense	probably benign	0.05
IGL00911:Clstn1	APN	4	149643191	splice site	probably benign
IGL01394:Clstn1	APN	4	149634782	missense	possibly damaging	0.87
IGL02193:Clstn1	APN	4	149645352	missense	probably benign	0.03
IGL02406:Clstn1	APN	4	149627359	missense	probably damaging	1.00
IGL02501:Clstn1	APN	4	149631842	missense	probably damaging	1.00
IGL02641:Clstn1	APN	4	149629511	missense	probably null	1.00
R0012:Clstn1	UTSW	4	149634796	missense	probably damaging	0.96
R0020:Clstn1	UTSW	4	149634796	missense	probably damaging	0.96
R0021:Clstn1	UTSW	4	149634796	missense	probably damaging	0.96
R0026:Clstn1	UTSW	4	149634796	missense	probably damaging	0.96
R0031:Clstn1	UTSW	4	149634796	missense	probably damaging	0.96
R0038:Clstn1	UTSW	4	149634796	missense	probably damaging	0.96
R0062:Clstn1	UTSW	4	149634796	missense	probably damaging	0.96
R0193:Clstn1	UTSW	4	149634796	missense	probably damaging	0.96
R0279:Clstn1	UTSW	4	149643674	missense	probably damaging	1.00
R0394:Clstn1	UTSW	4	149644178	missense	probably benign	0.00
R0609:Clstn1	UTSW	4	149629300	splice site	probably null
R0685:Clstn1	UTSW	4	149646855	missense	probably benign	0.24
R0724:Clstn1	UTSW	4	149643624	missense	possibly damaging	0.84
R1016:Clstn1	UTSW	4	149646829	missense	probably benign	0.21
R1470:Clstn1	UTSW	4	149634722	missense	possibly damaging	0.94
R1470:Clstn1	UTSW	4	149634722	missense	possibly damaging	0.94
R1622:Clstn1	UTSW	4	149629407	missense	probably damaging	0.97
R1680:Clstn1	UTSW	4	149643726	missense	probably benign	0.02
R3803:Clstn1	UTSW	4	149635339	missense	probably damaging	0.99
R3836:Clstn1	UTSW	4	149638333	missense	probably damaging	1.00
R3838:Clstn1	UTSW	4	149638333	missense	probably damaging	1.00
R4923:Clstn1	UTSW	4	149645029	missense	probably benign	0.07
R5024:Clstn1	UTSW	4	149635294	missense	possibly damaging	0.91
R5919:Clstn1	UTSW	4	149635246	missense	probably damaging	1.00
R6269:Clstn1	UTSW	4	149644067	missense	probably benign	0.00
R6354:Clstn1	UTSW	4	149643216	missense	probably benign	0.05
R6382:Clstn1	UTSW	4	149626120	splice site	probably null
R6573:Clstn1	UTSW	4	149643689	missense	probably damaging	1.00
R7342:Clstn1	UTSW	4	149629430	missense	probably damaging	0.98
R7457:Clstn1	UTSW	4	149634916	missense	probably benign	0.03
R7571:Clstn1	UTSW	4	149646287	missense	probably benign	0.38
R7682:Clstn1	UTSW	4	149626101	missense	possibly damaging	0.72
R7738:Clstn1	UTSW	4	149635354	missense	probably damaging	1.00
R7803:Clstn1	UTSW	4	149631871	missense	probably damaging	1.00
R7904:Clstn1	UTSW	4	149614137	missense	probably benign	0.01
R7918:Clstn1	UTSW	4	149644051	missense	probably damaging	0.98
R8007:Clstn1	UTSW	4	149631848	missense	probably damaging	1.00
R8821:Clstn1	UTSW	4	149646323	missense	probably benign	0.00
R8831:Clstn1	UTSW	4	149646323	missense	probably benign	0.00
R9169:Clstn1	UTSW	4	149646865	missense	possibly damaging	0.68
R9173:Clstn1	UTSW	4	149626107	missense	probably benign	0.08
R9463:Clstn1	UTSW	4	149614107	missense	possibly damaging	0.92
R9491:Clstn1	UTSW	4	149647472	missense	probably damaging	1.00
R9615:Clstn1	UTSW	4	149638300	missense	probably damaging	1.00
X0020:Clstn1	UTSW	4	149635251	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAACCCCTTAGTGAGGCACTGAAC -3'
(R):5'- GTGTCCCCAGCATAGAACGAAGAG -3'

Sequencing Primer
(F):5'- TTAGTGAGGCACTGAACCACTC -3'
(R):5'- ACCCAGTCCCTGTGAGGAG -3'

Posted On

2013-05-09