Incidental Mutation 'R0064:Tns3'
ID 34414
Institutional Source Beutler Lab
Gene Symbol Tns3
Ensembl Gene ENSMUSG00000020422
Gene Name tensin 3
Synonyms F830010I22Rik, Tens1, TEM6
MMRRC Submission 038356-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.327) question?
Stock # R0064 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 8381652-8614681 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) G to A at 8385856 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 1381 (Q1381*)
Ref Sequence ENSEMBL: ENSMUSP00000020695 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020695]
AlphaFold Q5SSZ5
Predicted Effect probably null
Transcript: ENSMUST00000020695
AA Change: Q1381*
SMART Domains Protein: ENSMUSP00000020695
Gene: ENSMUSG00000020422
AA Change: Q1381*

DomainStartEndE-ValueType
SCOP:d1d5ra2 1 171 5e-28 SMART
PTEN_C2 173 300 1.15e-48 SMART
low complexity region 854 864 N/A INTRINSIC
low complexity region 1102 1126 N/A INTRINSIC
SH2 1165 1268 1.32e-18 SMART
PTB 1301 1438 3.14e-24 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 100% (55/55)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit one third postnatal lethality, reduced body weight, growth retardation, smaller digestive tracts with defects in villi and enterocyte differentiation, abnormal lung morphology, and thinner bones with decreased chondrocyte proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 G T 11: 110,035,698 (GRCm39) L641M probably damaging Het
Abca9 A C 11: 110,035,697 (GRCm39) L641R probably damaging Het
Abhd18 A G 3: 40,888,288 (GRCm39) I377M probably benign Het
Arhgef17 C A 7: 100,530,561 (GRCm39) M1408I probably benign Het
Bcl2a1a G C 9: 88,839,516 (GRCm39) G138A probably damaging Het
C4b A G 17: 34,957,830 (GRCm39) L617P probably damaging Het
Ccdc25 T A 14: 66,091,561 (GRCm39) I60K possibly damaging Het
Cdk1 T C 10: 69,180,907 (GRCm39) D101G probably benign Het
Cdon A G 9: 35,400,523 (GRCm39) H1079R probably benign Het
Cep126 A T 9: 8,130,183 (GRCm39) probably benign Het
Cic T A 7: 24,986,565 (GRCm39) S1299T probably damaging Het
Cic C A 7: 24,986,566 (GRCm39) S1299Y probably damaging Het
Clstn1 G A 4: 149,719,253 (GRCm39) V361M probably damaging Het
Crlf3 A G 11: 79,948,728 (GRCm39) I239T possibly damaging Het
Cstf2t T A 19: 31,060,699 (GRCm39) N78K probably damaging Het
Cul1 A G 6: 47,479,349 (GRCm39) probably benign Het
D430041D05Rik T G 2: 104,079,502 (GRCm39) T1194P probably damaging Het
Fbp2 A T 13: 63,001,862 (GRCm39) F118I probably damaging Het
Fbxw14 A T 9: 109,116,660 (GRCm39) Y16* probably null Het
Fgd3 T G 13: 49,449,901 (GRCm39) D116A possibly damaging Het
Gm7168 C T 17: 14,170,121 (GRCm39) T496I probably benign Het
Hsh2d G A 8: 72,954,304 (GRCm39) D229N probably benign Het
Klhl5 T A 5: 65,298,631 (GRCm39) S137T probably benign Het
Knl1 T A 2: 118,906,724 (GRCm39) N1604K probably benign Het
Lpcat1 T A 13: 73,662,585 (GRCm39) N463K probably damaging Het
Lpl A G 8: 69,345,356 (GRCm39) H120R probably damaging Het
Man1a2 A T 3: 100,499,199 (GRCm39) S412T possibly damaging Het
Mcc C G 18: 44,652,583 (GRCm39) probably benign Het
Myo18a G T 11: 77,738,170 (GRCm39) R1704L probably damaging Het
Nlrc3 G T 16: 3,781,951 (GRCm39) T486K possibly damaging Het
Nrip1 T A 16: 76,091,558 (GRCm39) probably benign Het
Nutf2 A G 8: 106,605,441 (GRCm39) D92G probably damaging Het
Obscn A C 11: 58,918,292 (GRCm39) V6260G probably damaging Het
Or10a2 T C 7: 106,673,487 (GRCm39) F151L probably benign Het
Or2ak7 G A 11: 58,575,301 (GRCm39) V201M probably benign Het
Plce1 T C 19: 38,769,228 (GRCm39) probably null Het
Pmpca C A 2: 26,285,519 (GRCm39) D498E probably benign Het
Pnpla7 G T 2: 24,887,239 (GRCm39) E28* probably null Het
Polg C A 7: 79,111,632 (GRCm39) W206C probably damaging Het
Ptprt C T 2: 161,769,711 (GRCm39) probably benign Het
Slc7a14 T C 3: 31,281,209 (GRCm39) D367G probably damaging Het
Spata31 T C 13: 65,069,912 (GRCm39) Y687H probably damaging Het
Sybu T A 15: 44,536,389 (GRCm39) T646S probably benign Het
Thbs1 A T 2: 117,954,395 (GRCm39) probably null Het
Tie1 A G 4: 118,346,898 (GRCm39) V2A possibly damaging Het
Tma16 A T 8: 66,929,457 (GRCm39) I179K possibly damaging Het
Trank1 A G 9: 111,172,263 (GRCm39) D84G probably damaging Het
Ttc3 A T 16: 94,223,106 (GRCm39) H197L possibly damaging Het
Urb1 A G 16: 90,576,028 (GRCm39) F843L probably benign Het
Vmn1r24 T G 6: 57,933,003 (GRCm39) I172L probably benign Het
Vmn2r1 T A 3: 64,012,209 (GRCm39) I690N possibly damaging Het
Vmn2r111 T A 17: 22,791,053 (GRCm39) I82L probably benign Het
Zfp287 A T 11: 62,605,764 (GRCm39) L370H possibly damaging Het
Zfp608 A T 18: 55,031,888 (GRCm39) I684N probably benign Het
Other mutations in Tns3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Tns3 APN 11 8,401,066 (GRCm39) missense probably benign 0.42
IGL00822:Tns3 APN 11 8,393,976 (GRCm39) missense probably damaging 0.99
IGL01075:Tns3 APN 11 8,428,399 (GRCm39) missense probably benign 0.45
IGL01286:Tns3 APN 11 8,442,617 (GRCm39) missense probably benign 0.01
IGL01680:Tns3 APN 11 8,498,937 (GRCm39) missense probably damaging 1.00
IGL01687:Tns3 APN 11 8,442,798 (GRCm39) missense probably damaging 1.00
IGL01734:Tns3 APN 11 8,469,192 (GRCm39) splice site probably benign
IGL01844:Tns3 APN 11 8,387,177 (GRCm39) missense possibly damaging 0.58
IGL01984:Tns3 APN 11 8,498,992 (GRCm39) nonsense probably null
IGL02137:Tns3 APN 11 8,442,578 (GRCm39) missense possibly damaging 0.93
IGL02273:Tns3 APN 11 8,384,531 (GRCm39) missense probably damaging 1.00
IGL02623:Tns3 APN 11 8,387,141 (GRCm39) missense probably damaging 1.00
IGL02697:Tns3 APN 11 8,442,346 (GRCm39) missense probably benign 0.00
IGL02829:Tns3 APN 11 8,469,564 (GRCm39) missense probably damaging 1.00
ANU74:Tns3 UTSW 11 8,442,149 (GRCm39) missense probably benign 0.38
R0020:Tns3 UTSW 11 8,495,227 (GRCm39) critical splice donor site probably null
R0064:Tns3 UTSW 11 8,385,856 (GRCm39) nonsense probably null
R0370:Tns3 UTSW 11 8,395,730 (GRCm39) missense possibly damaging 0.80
R0388:Tns3 UTSW 11 8,395,703 (GRCm39) missense probably benign 0.07
R0410:Tns3 UTSW 11 8,385,852 (GRCm39) missense probably benign 0.02
R0496:Tns3 UTSW 11 8,497,262 (GRCm39) splice site probably benign
R0562:Tns3 UTSW 11 8,443,262 (GRCm39) missense possibly damaging 0.93
R0626:Tns3 UTSW 11 8,443,121 (GRCm39) missense probably benign 0.04
R0736:Tns3 UTSW 11 8,469,474 (GRCm39) missense possibly damaging 0.94
R0893:Tns3 UTSW 11 8,443,302 (GRCm39) missense probably damaging 1.00
R1367:Tns3 UTSW 11 8,398,704 (GRCm39) missense probably benign 0.01
R1386:Tns3 UTSW 11 8,468,261 (GRCm39) missense probably benign 0.02
R1975:Tns3 UTSW 11 8,385,738 (GRCm39) missense probably benign 0.04
R2205:Tns3 UTSW 11 8,481,719 (GRCm39) missense probably damaging 1.00
R2319:Tns3 UTSW 11 8,491,200 (GRCm39) missense probably damaging 1.00
R2830:Tns3 UTSW 11 8,385,870 (GRCm39) missense probably damaging 1.00
R3720:Tns3 UTSW 11 8,442,999 (GRCm39) missense probably damaging 1.00
R3765:Tns3 UTSW 11 8,401,133 (GRCm39) missense probably benign 0.00
R3817:Tns3 UTSW 11 8,384,619 (GRCm39) missense probably damaging 1.00
R4058:Tns3 UTSW 11 8,442,275 (GRCm39) missense probably damaging 1.00
R4599:Tns3 UTSW 11 8,481,747 (GRCm39) missense probably damaging 1.00
R4631:Tns3 UTSW 11 8,401,119 (GRCm39) missense probably benign 0.30
R4731:Tns3 UTSW 11 8,400,986 (GRCm39) missense probably benign 0.28
R4732:Tns3 UTSW 11 8,400,986 (GRCm39) missense probably benign 0.28
R4733:Tns3 UTSW 11 8,400,986 (GRCm39) missense probably benign 0.28
R5472:Tns3 UTSW 11 8,401,092 (GRCm39) missense probably benign
R5749:Tns3 UTSW 11 8,401,177 (GRCm39) missense probably benign 0.01
R5807:Tns3 UTSW 11 8,443,211 (GRCm39) missense probably damaging 1.00
R5844:Tns3 UTSW 11 8,384,580 (GRCm39) missense probably damaging 1.00
R5942:Tns3 UTSW 11 8,385,860 (GRCm39) missense probably damaging 1.00
R5982:Tns3 UTSW 11 8,442,245 (GRCm39) missense probably damaging 0.99
R6025:Tns3 UTSW 11 8,442,578 (GRCm39) missense possibly damaging 0.93
R6266:Tns3 UTSW 11 8,442,987 (GRCm39) missense probably damaging 1.00
R6322:Tns3 UTSW 11 8,442,147 (GRCm39) missense probably benign 0.01
R6536:Tns3 UTSW 11 8,384,531 (GRCm39) missense probably damaging 1.00
R6577:Tns3 UTSW 11 8,499,058 (GRCm39) missense probably damaging 1.00
R6577:Tns3 UTSW 11 8,499,057 (GRCm39) missense probably damaging 1.00
R6864:Tns3 UTSW 11 8,443,196 (GRCm39) missense probably damaging 1.00
R6897:Tns3 UTSW 11 8,481,743 (GRCm39) missense probably damaging 1.00
R7108:Tns3 UTSW 11 8,387,251 (GRCm39) missense probably benign 0.00
R7443:Tns3 UTSW 11 8,401,442 (GRCm39) missense probably benign 0.01
R7459:Tns3 UTSW 11 8,442,793 (GRCm39) missense probably benign 0.16
R7474:Tns3 UTSW 11 8,480,894 (GRCm39) missense probably damaging 1.00
R7576:Tns3 UTSW 11 8,491,192 (GRCm39) missense possibly damaging 0.78
R7979:Tns3 UTSW 11 8,442,701 (GRCm39) missense probably benign 0.01
R8055:Tns3 UTSW 11 8,495,343 (GRCm39) missense probably damaging 1.00
R8057:Tns3 UTSW 11 8,442,773 (GRCm39) missense probably benign
R8077:Tns3 UTSW 11 8,395,667 (GRCm39) missense probably damaging 1.00
R8518:Tns3 UTSW 11 8,442,971 (GRCm39) missense probably damaging 0.96
R8523:Tns3 UTSW 11 8,398,779 (GRCm39) missense probably damaging 1.00
R8790:Tns3 UTSW 11 8,468,273 (GRCm39) missense probably damaging 0.99
R9228:Tns3 UTSW 11 8,400,094 (GRCm39) missense probably damaging 1.00
R9374:Tns3 UTSW 11 8,442,606 (GRCm39) missense probably damaging 1.00
R9476:Tns3 UTSW 11 8,395,702 (GRCm39) missense probably damaging 0.99
R9510:Tns3 UTSW 11 8,395,702 (GRCm39) missense probably damaging 0.99
R9594:Tns3 UTSW 11 8,401,142 (GRCm39) missense possibly damaging 0.79
R9595:Tns3 UTSW 11 8,401,142 (GRCm39) missense possibly damaging 0.79
R9596:Tns3 UTSW 11 8,401,142 (GRCm39) missense possibly damaging 0.79
R9624:Tns3 UTSW 11 8,401,142 (GRCm39) missense possibly damaging 0.79
R9629:Tns3 UTSW 11 8,401,142 (GRCm39) missense possibly damaging 0.79
T0975:Tns3 UTSW 11 8,401,146 (GRCm39) missense probably benign 0.00
T0975:Tns3 UTSW 11 8,499,100 (GRCm39) start gained probably benign
T0975:Tns3 UTSW 11 8,429,518 (GRCm39) missense probably benign
X0005:Tns3 UTSW 11 8,429,518 (GRCm39) missense probably benign
X0005:Tns3 UTSW 11 8,401,224 (GRCm39) missense probably benign 0.00
Z1177:Tns3 UTSW 11 8,401,014 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCACCGACAATGACTGCTTTGC -3'
(R):5'- CTTCCCACTGGGGAAATAAGGAACC -3'

Sequencing Primer
(F):5'- ACAATGACTGCTTTGCTTTGTCTG -3'
(R):5'- GGGAAATAAGGAACCCACCCAG -3'
Posted On 2013-05-09