Incidental Mutation 'R4599:Spint1'
ID 345410
Institutional Source Beutler Lab
Gene Symbol Spint1
Ensembl Gene ENSMUSG00000027315
Gene Name serine protease inhibitor, Kunitz type 1
Synonyms HAI-1
MMRRC Submission 041815-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4599 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 119237362-119249527 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 119246460 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 342 (S342P)
Ref Sequence ENSEMBL: ENSMUSP00000106441 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028783] [ENSMUST00000110816] [ENSMUST00000110817]
AlphaFold Q9R097
Predicted Effect probably damaging
Transcript: ENSMUST00000028783
AA Change: S342P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028783
Gene: ENSMUSG00000027315
AA Change: S342P

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
MANEC 39 134 1.18e-39 SMART
Blast:PKD 162 237 6e-19 BLAST
KU 242 295 3.75e-19 SMART
LDLa 312 349 2.12e-8 SMART
KU 367 420 8.04e-19 SMART
transmembrane domain 444 466 N/A INTRINSIC
low complexity region 474 492 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110816
AA Change: S342P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106440
Gene: ENSMUSG00000027315
AA Change: S342P

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
MANEC 39 134 1.18e-39 SMART
Blast:PKD 162 237 6e-19 BLAST
KU 242 295 3.75e-19 SMART
LDLa 312 349 2.12e-8 SMART
KU 367 420 8.04e-19 SMART
transmembrane domain 444 466 N/A INTRINSIC
low complexity region 474 492 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110817
AA Change: S342P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106441
Gene: ENSMUSG00000027315
AA Change: S342P

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
MANEC 39 134 1.18e-39 SMART
Blast:PKD 162 237 6e-19 BLAST
KU 242 295 3.75e-19 SMART
LDLa 312 349 2.12e-8 SMART
KU 367 420 8.04e-19 SMART
transmembrane domain 444 466 N/A INTRINSIC
low complexity region 474 492 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134872
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139903
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Kunitz family of serine protease inhibitors. The protein is a potent inhibitor specific for HGF activator and is thought to be involved in the regulation of the proteolytic activation of HGF in injured tissues. Alternative splicing results in multiple variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice exhibit embryonic lethality at E10.5 or earlier, growth retardation, and widespread cell apoptosis. Placental development is impaired with abnormalities in branching morphogenesis, the formation of the labyrinth layer and placental function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 T C 7: 120,255,403 V930A probably benign Het
Ankrd13b T C 11: 77,471,668 R677G probably benign Het
Apc T A 18: 34,317,987 Y2611* probably null Het
Apold1 A G 6: 134,984,069 Y162C probably damaging Het
Atp6v0a4 T C 6: 38,078,802 I325V probably benign Het
Cab39 A G 1: 85,848,329 Y249C probably damaging Het
Cd22 T A 7: 30,875,900 H239L probably damaging Het
Chrna7 A G 7: 63,103,790 M327T probably damaging Het
Clock T C 5: 76,235,810 M499V probably benign Het
Clspn A G 4: 126,581,460 E1002G probably benign Het
Clta C T 4: 44,012,819 P10S probably damaging Het
Col5a3 A G 9: 20,774,559 probably null Het
Coq6 T C 12: 84,362,139 V30A probably benign Het
Csmd2 G T 4: 127,988,128 R20L probably benign Het
D430041D05Rik A T 2: 104,208,183 V1547D probably damaging Het
Dapk1 C T 13: 60,718,047 P153S probably benign Het
Dock2 T A 11: 34,239,536 Y1545F probably damaging Het
Dpp6 G T 5: 27,634,548 G354C probably damaging Het
Dyrk1b T C 7: 28,182,431 L105P probably damaging Het
Epor A G 9: 21,961,859 S86P probably benign Het
Fam166b T C 4: 43,427,574 H250R possibly damaging Het
Gale C A 4: 135,967,837 S341* probably null Het
Galnt4 T A 10: 99,109,493 V360E probably damaging Het
Gart A T 16: 91,622,945 C24* probably null Het
Gcnt2 G T 13: 40,887,490 V42L probably benign Het
Herc6 A G 6: 57,659,713 I805V probably benign Het
Ints12 T A 3: 133,098,453 I67N probably benign Het
Irx1 C A 13: 71,960,113 R150L probably damaging Het
Kif26b A G 1: 178,530,459 Y45C unknown Het
Krt35 T C 11: 100,094,008 T275A probably damaging Het
Laptm5 G T 4: 130,916,005 probably benign Het
Lin7a T C 10: 107,412,166 S111P unknown Het
Med27 A G 2: 29,524,458 D159G probably damaging Het
Msh2 A G 17: 87,708,578 K546R probably damaging Het
Myo1a A T 10: 127,720,151 probably null Het
Myo1c T C 11: 75,668,193 F604L probably damaging Het
Myrip A G 9: 120,464,784 K782E probably damaging Het
Ndc80 T C 17: 71,521,068 D88G probably damaging Het
Nrxn2 A G 19: 6,455,252 D375G probably damaging Het
Olfr1380 T C 11: 49,564,718 S266P probably damaging Het
Olfr676 A G 7: 105,036,073 I292V probably benign Het
Padi3 T C 4: 140,798,111 H187R probably damaging Het
Pcdhgb1 A T 18: 37,681,557 N367I probably damaging Het
Pdrg1 T C 2: 153,012,390 I77V probably benign Het
Pfas T C 11: 68,991,069 E930G probably benign Het
Pik3cb C T 9: 99,061,764 R662Q probably benign Het
Pla2g4e T G 2: 120,186,382 H226P possibly damaging Het
Plxnd1 A T 6: 115,994,276 V177E probably damaging Het
Prmt7 A G 8: 106,250,329 S558G possibly damaging Het
Pspc1 A C 14: 56,777,789 probably null Het
Rilp T C 11: 75,512,760 S343P probably benign Het
Ror1 A G 4: 100,407,910 M194V probably damaging Het
Rsu1 T C 2: 13,170,004 Y225C probably damaging Het
Rundc1 A G 11: 101,433,926 N486S probably damaging Het
Sema6d T A 2: 124,654,231 I65N probably damaging Het
Slc5a11 A G 7: 123,258,378 E230G probably benign Het
Stard3nl A G 13: 19,367,753 S214P probably damaging Het
Tcp10a A C 17: 7,336,924 T271P probably damaging Het
Tie1 A G 4: 118,472,634 Y1091H probably benign Het
Tlr12 T C 4: 128,617,332 Y375C probably benign Het
Tmem107 T A 11: 69,071,448 M77K probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tns3 T C 11: 8,531,747 K202E probably damaging Het
Tspoap1 C T 11: 87,779,521 P1634L probably damaging Het
Ttc7b G A 12: 100,500,117 R79C probably damaging Het
Ush2a A G 1: 188,911,647 N4402S probably benign Het
Vmn2r13 A T 5: 109,156,456 I703N probably damaging Het
Xrcc4 A G 13: 90,062,007 probably null Het
Zp3 A T 5: 135,984,235 K168* probably null Het
Other mutations in Spint1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01351:Spint1 APN 2 119246455 missense probably damaging 1.00
IGL02065:Spint1 APN 2 119238217 missense probably benign 0.02
R0206:Spint1 UTSW 2 119248345 splice site probably benign
R0208:Spint1 UTSW 2 119248345 splice site probably benign
R0415:Spint1 UTSW 2 119245615 missense probably damaging 1.00
R0691:Spint1 UTSW 2 119246467 missense probably damaging 1.00
R1236:Spint1 UTSW 2 119245573 missense probably benign 0.05
R2190:Spint1 UTSW 2 119238180 missense probably benign 0.01
R3890:Spint1 UTSW 2 119248802 missense probably benign 0.28
R6280:Spint1 UTSW 2 119245278 missense possibly damaging 0.89
R8739:Spint1 UTSW 2 119248805 missense possibly damaging 0.82
R9735:Spint1 UTSW 2 119246416 missense probably damaging 1.00
S24628:Spint1 UTSW 2 119245615 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGCCCGGTTTACAGATGG -3'
(R):5'- CACCTTTGTCACTGAGGAAATGG -3'

Sequencing Primer
(F):5'- CCCGGTTTACAGATGGGAGGAG -3'
(R):5'- GGATATTCTGAAGCTCATCAAAGCCG -3'
Posted On 2015-09-25