Incidental Mutation 'R4599:Myo1c'
ID 345457
Institutional Source Beutler Lab
Gene Symbol Myo1c
Ensembl Gene ENSMUSG00000017774
Gene Name myosin IC
Synonyms myr2, mm1beta, C80397, myosin-Ibeta
MMRRC Submission 041815-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.684) question?
Stock # R4599 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 75541330-75564736 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 75559019 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 604 (F604L)
Ref Sequence ENSEMBL: ENSMUSP00000099563 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069057] [ENSMUST00000102504] [ENSMUST00000102505] [ENSMUST00000108431]
AlphaFold Q9WTI7
Predicted Effect probably damaging
Transcript: ENSMUST00000069057
AA Change: F569L

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000070388
Gene: ENSMUSG00000017774
AA Change: F569L

DomainStartEndE-ValueType
MYSc 5 697 N/A SMART
IQ 698 720 3.85e-3 SMART
IQ 721 743 2.09e-4 SMART
Blast:MYSc 751 780 5e-9 BLAST
low complexity region 804 815 N/A INTRINSIC
Pfam:Myosin_TH1 838 1024 1.9e-41 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102504
AA Change: F569L

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000099562
Gene: ENSMUSG00000017774
AA Change: F569L

DomainStartEndE-ValueType
MYSc 5 697 N/A SMART
IQ 698 720 3.85e-3 SMART
IQ 721 743 2.09e-4 SMART
Blast:MYSc 751 780 5e-9 BLAST
low complexity region 804 815 N/A INTRINSIC
Pfam:Myosin_TH1 838 1024 1.9e-41 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102505
AA Change: F604L

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000099563
Gene: ENSMUSG00000017774
AA Change: F604L

DomainStartEndE-ValueType
MYSc 40 732 N/A SMART
IQ 733 755 3.85e-3 SMART
IQ 756 778 2.09e-4 SMART
Blast:MYSc 786 815 6e-9 BLAST
low complexity region 839 850 N/A INTRINSIC
Pfam:Myosin_TH1 874 1052 2.9e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108431
AA Change: F585L

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000104069
Gene: ENSMUSG00000017774
AA Change: F585L

DomainStartEndE-ValueType
MYSc 21 713 N/A SMART
IQ 714 736 3.85e-3 SMART
IQ 737 759 2.09e-4 SMART
Blast:MYSc 767 796 5e-9 BLAST
low complexity region 820 831 N/A INTRINSIC
Pfam:Myosin_TH1 854 1040 3.3e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123064
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146419
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151174
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155027
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148659
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the unconventional myosin protein family, which are actin-based molecular motors. The protein is found in the cytoplasm, and one isoform with a unique N-terminus is also found in the nucleus. The protein functions in intracellular vesicle transport to the plasma membrane. The nuclear isoform associates with RNA polymerase I and II and functions in transcription initiation. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-in (Y61G) mutation that sensitizes to N6-modified ADP analogs display altered fast adaption in vestibular hair cells. Mice homozygous for a nuclear isoform-specifc knock-out allele exhibit minor changes in bone marrow density and red blood cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 T C 7: 119,854,626 (GRCm39) V930A probably benign Het
Ankrd13b T C 11: 77,362,494 (GRCm39) R677G probably benign Het
Apc T A 18: 34,451,040 (GRCm39) Y2611* probably null Het
Apold1 A G 6: 134,961,032 (GRCm39) Y162C probably damaging Het
Atp6v0a4 T C 6: 38,055,737 (GRCm39) I325V probably benign Het
Cab39 A G 1: 85,776,050 (GRCm39) Y249C probably damaging Het
Cd22 T A 7: 30,575,325 (GRCm39) H239L probably damaging Het
Chrna7 A G 7: 62,753,538 (GRCm39) M327T probably damaging Het
Cimip2b T C 4: 43,427,574 (GRCm39) H250R possibly damaging Het
Clock T C 5: 76,383,657 (GRCm39) M499V probably benign Het
Clspn A G 4: 126,475,253 (GRCm39) E1002G probably benign Het
Clta C T 4: 44,012,819 (GRCm39) P10S probably damaging Het
Col5a3 A G 9: 20,685,855 (GRCm39) probably null Het
Coq6 T C 12: 84,408,913 (GRCm39) V30A probably benign Het
Csmd2 G T 4: 127,881,921 (GRCm39) R20L probably benign Het
D430041D05Rik A T 2: 104,038,528 (GRCm39) V1547D probably damaging Het
Dapk1 C T 13: 60,865,861 (GRCm39) P153S probably benign Het
Dock2 T A 11: 34,189,536 (GRCm39) Y1545F probably damaging Het
Dpp6 G T 5: 27,839,546 (GRCm39) G354C probably damaging Het
Dyrk1b T C 7: 27,881,856 (GRCm39) L105P probably damaging Het
Epor A G 9: 21,873,155 (GRCm39) S86P probably benign Het
Gale C A 4: 135,695,148 (GRCm39) S341* probably null Het
Galnt4 T A 10: 98,945,355 (GRCm39) V360E probably damaging Het
Gart A T 16: 91,419,833 (GRCm39) C24* probably null Het
Gcnt2 G T 13: 41,040,966 (GRCm39) V42L probably benign Het
Herc6 A G 6: 57,636,698 (GRCm39) I805V probably benign Het
Ints12 T A 3: 132,804,214 (GRCm39) I67N probably benign Het
Irx1 C A 13: 72,108,232 (GRCm39) R150L probably damaging Het
Kif26b A G 1: 178,358,024 (GRCm39) Y45C unknown Het
Krt35 T C 11: 99,984,834 (GRCm39) T275A probably damaging Het
Laptm5 G T 4: 130,643,316 (GRCm39) probably benign Het
Lin7a T C 10: 107,248,027 (GRCm39) S111P unknown Het
Med27 A G 2: 29,414,470 (GRCm39) D159G probably damaging Het
Msh2 A G 17: 88,016,006 (GRCm39) K546R probably damaging Het
Myo1a A T 10: 127,556,020 (GRCm39) probably null Het
Myrip A G 9: 120,293,850 (GRCm39) K782E probably damaging Het
Ndc80 T C 17: 71,828,063 (GRCm39) D88G probably damaging Het
Nrxn2 A G 19: 6,505,282 (GRCm39) D375G probably damaging Het
Or2y10 T C 11: 49,455,545 (GRCm39) S266P probably damaging Het
Or52e7 A G 7: 104,685,280 (GRCm39) I292V probably benign Het
Padi3 T C 4: 140,525,422 (GRCm39) H187R probably damaging Het
Pcdhgb1 A T 18: 37,814,610 (GRCm39) N367I probably damaging Het
Pdrg1 T C 2: 152,854,310 (GRCm39) I77V probably benign Het
Pfas T C 11: 68,881,895 (GRCm39) E930G probably benign Het
Pik3cb C T 9: 98,943,817 (GRCm39) R662Q probably benign Het
Pla2g4e T G 2: 120,016,863 (GRCm39) H226P possibly damaging Het
Plxnd1 A T 6: 115,971,237 (GRCm39) V177E probably damaging Het
Prmt7 A G 8: 106,976,961 (GRCm39) S558G possibly damaging Het
Pspc1 A C 14: 57,015,246 (GRCm39) probably null Het
Rilp T C 11: 75,403,586 (GRCm39) S343P probably benign Het
Ror1 A G 4: 100,265,107 (GRCm39) M194V probably damaging Het
Rsu1 T C 2: 13,174,815 (GRCm39) Y225C probably damaging Het
Rundc1 A G 11: 101,324,752 (GRCm39) N486S probably damaging Het
Sema6d T A 2: 124,496,151 (GRCm39) I65N probably damaging Het
Slc5a11 A G 7: 122,857,601 (GRCm39) E230G probably benign Het
Spint1 T C 2: 119,076,941 (GRCm39) S342P probably damaging Het
Stard3nl A G 13: 19,551,923 (GRCm39) S214P probably damaging Het
Tcp10a A C 17: 7,604,323 (GRCm39) T271P probably damaging Het
Tie1 A G 4: 118,329,831 (GRCm39) Y1091H probably benign Het
Tlr12 T C 4: 128,511,125 (GRCm39) Y375C probably benign Het
Tmem107 T A 11: 68,962,274 (GRCm39) M77K probably damaging Het
Tns2 C T 15: 102,017,369 (GRCm39) R281C probably damaging Het
Tns3 T C 11: 8,481,747 (GRCm39) K202E probably damaging Het
Tspoap1 C T 11: 87,670,347 (GRCm39) P1634L probably damaging Het
Ttc7b G A 12: 100,466,376 (GRCm39) R79C probably damaging Het
Ush2a A G 1: 188,643,844 (GRCm39) N4402S probably benign Het
Vmn2r13 A T 5: 109,304,322 (GRCm39) I703N probably damaging Het
Xrcc4 A G 13: 90,210,126 (GRCm39) probably null Het
Zp3 A T 5: 136,013,089 (GRCm39) K168* probably null Het
Other mutations in Myo1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01346:Myo1c APN 11 75,563,076 (GRCm39) missense probably damaging 1.00
IGL02054:Myo1c APN 11 75,551,962 (GRCm39) missense probably benign 0.30
IGL02115:Myo1c APN 11 75,552,417 (GRCm39) missense probably damaging 0.99
IGL02375:Myo1c APN 11 75,552,400 (GRCm39) missense probably benign 0.00
IGL02878:Myo1c APN 11 75,559,859 (GRCm39) missense possibly damaging 0.93
IGL03008:Myo1c APN 11 75,549,240 (GRCm39) missense probably benign 0.13
Sweeper UTSW 11 75,560,856 (GRCm39) nonsense probably null
R0070:Myo1c UTSW 11 75,551,076 (GRCm39) missense probably benign 0.39
R0070:Myo1c UTSW 11 75,551,076 (GRCm39) missense probably benign 0.39
R0138:Myo1c UTSW 11 75,551,827 (GRCm39) missense possibly damaging 0.92
R0200:Myo1c UTSW 11 75,563,008 (GRCm39) missense probably benign 0.00
R0227:Myo1c UTSW 11 75,549,520 (GRCm39) missense probably benign 0.34
R0257:Myo1c UTSW 11 75,556,342 (GRCm39) critical splice acceptor site probably null
R0513:Myo1c UTSW 11 75,556,657 (GRCm39) splice site probably null
R0587:Myo1c UTSW 11 75,548,616 (GRCm39) missense probably damaging 1.00
R0667:Myo1c UTSW 11 75,559,338 (GRCm39) missense probably damaging 1.00
R1469:Myo1c UTSW 11 75,560,787 (GRCm39) missense probably damaging 1.00
R1469:Myo1c UTSW 11 75,560,787 (GRCm39) missense probably damaging 1.00
R1793:Myo1c UTSW 11 75,548,415 (GRCm39) missense probably damaging 0.98
R1922:Myo1c UTSW 11 75,559,055 (GRCm39) missense probably benign
R2000:Myo1c UTSW 11 75,561,405 (GRCm39) missense probably damaging 1.00
R3983:Myo1c UTSW 11 75,552,325 (GRCm39) missense probably benign 0.05
R4583:Myo1c UTSW 11 75,562,688 (GRCm39) missense possibly damaging 0.72
R4671:Myo1c UTSW 11 75,560,856 (GRCm39) nonsense probably null
R4682:Myo1c UTSW 11 75,560,856 (GRCm39) nonsense probably null
R4708:Myo1c UTSW 11 75,560,856 (GRCm39) nonsense probably null
R4709:Myo1c UTSW 11 75,560,856 (GRCm39) nonsense probably null
R4742:Myo1c UTSW 11 75,560,856 (GRCm39) nonsense probably null
R4770:Myo1c UTSW 11 75,551,139 (GRCm39) nonsense probably null
R4888:Myo1c UTSW 11 75,560,053 (GRCm39) missense probably damaging 1.00
R4915:Myo1c UTSW 11 75,547,135 (GRCm39) start codon destroyed probably null
R4934:Myo1c UTSW 11 75,562,676 (GRCm39) missense probably damaging 1.00
R4971:Myo1c UTSW 11 75,562,414 (GRCm39) missense probably damaging 1.00
R5319:Myo1c UTSW 11 75,552,852 (GRCm39) missense possibly damaging 0.95
R5589:Myo1c UTSW 11 75,548,414 (GRCm39) missense possibly damaging 0.74
R5624:Myo1c UTSW 11 75,553,461 (GRCm39) missense probably damaging 0.99
R5756:Myo1c UTSW 11 75,549,240 (GRCm39) missense probably benign 0.42
R5959:Myo1c UTSW 11 75,548,345 (GRCm39) missense probably benign 0.37
R6160:Myo1c UTSW 11 75,541,568 (GRCm39) missense probably benign 0.00
R6559:Myo1c UTSW 11 75,562,461 (GRCm39) missense probably benign 0.42
R6568:Myo1c UTSW 11 75,562,461 (GRCm39) missense probably benign 0.42
R6569:Myo1c UTSW 11 75,562,461 (GRCm39) missense probably benign 0.42
R6574:Myo1c UTSW 11 75,547,124 (GRCm39) start gained probably benign
R6579:Myo1c UTSW 11 75,562,461 (GRCm39) missense probably benign 0.42
R6580:Myo1c UTSW 11 75,562,461 (GRCm39) missense probably benign 0.42
R6583:Myo1c UTSW 11 75,562,461 (GRCm39) missense probably benign 0.42
R6640:Myo1c UTSW 11 75,562,461 (GRCm39) missense probably benign 0.42
R6642:Myo1c UTSW 11 75,562,461 (GRCm39) missense probably benign 0.42
R6643:Myo1c UTSW 11 75,562,461 (GRCm39) missense probably benign 0.42
R6679:Myo1c UTSW 11 75,562,461 (GRCm39) missense probably benign 0.42
R6680:Myo1c UTSW 11 75,562,461 (GRCm39) missense probably benign 0.42
R6687:Myo1c UTSW 11 75,563,027 (GRCm39) missense probably benign
R6695:Myo1c UTSW 11 75,562,461 (GRCm39) missense probably benign 0.42
R6696:Myo1c UTSW 11 75,562,461 (GRCm39) missense probably benign 0.42
R6700:Myo1c UTSW 11 75,562,461 (GRCm39) missense probably benign 0.42
R6712:Myo1c UTSW 11 75,562,461 (GRCm39) missense probably benign 0.42
R6713:Myo1c UTSW 11 75,562,461 (GRCm39) missense probably benign 0.42
R6715:Myo1c UTSW 11 75,562,461 (GRCm39) missense probably benign 0.42
R7081:Myo1c UTSW 11 75,551,789 (GRCm39) missense probably benign
R7265:Myo1c UTSW 11 75,560,616 (GRCm39) missense possibly damaging 0.89
R7397:Myo1c UTSW 11 75,562,068 (GRCm39) missense probably benign 0.17
R7586:Myo1c UTSW 11 75,548,345 (GRCm39) missense possibly damaging 0.77
R7714:Myo1c UTSW 11 75,549,519 (GRCm39) missense probably damaging 1.00
R8260:Myo1c UTSW 11 75,546,942 (GRCm39) unclassified probably benign
R8341:Myo1c UTSW 11 75,562,253 (GRCm39) missense probably benign 0.42
R8466:Myo1c UTSW 11 75,549,213 (GRCm39) missense probably damaging 1.00
R8771:Myo1c UTSW 11 75,556,709 (GRCm39) missense probably benign
R8829:Myo1c UTSW 11 75,561,072 (GRCm39) missense probably benign 0.03
R8832:Myo1c UTSW 11 75,561,072 (GRCm39) missense probably benign 0.03
R9243:Myo1c UTSW 11 75,541,437 (GRCm39) unclassified probably benign
R9489:Myo1c UTSW 11 75,559,899 (GRCm39) missense probably benign 0.00
R9605:Myo1c UTSW 11 75,559,899 (GRCm39) missense probably benign 0.00
R9744:Myo1c UTSW 11 75,562,797 (GRCm39) missense probably damaging 1.00
R9782:Myo1c UTSW 11 75,549,273 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCTGAGGTCTCTAACGGG -3'
(R):5'- CTCATCAAAGCGACCTGAGAG -3'

Sequencing Primer
(F):5'- CTGAGGTCTCTAACGGGCTGAAAG -3'
(R):5'- CCGGAGAGTAACAAAGGTGGTCC -3'
Posted On 2015-09-25