Incidental Mutation 'R0267:Syn2'
ID34994
Institutional Source Beutler Lab
Gene Symbol Syn2
Ensembl Gene ENSMUSG00000009394
Gene Namesynapsin II
SynonymsSynapsin IIb, 2900074L19Rik, Synapsin IIa
MMRRC Submission 038493-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.139) question?
Stock #R0267 (G1)
Quality Score174
Status Validated
Chromosome6
Chromosomal Location115134902-115282006 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to G at 115254150 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000144785 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009538] [ENSMUST00000032462] [ENSMUST00000166681] [ENSMUST00000169345] [ENSMUST00000203450] [ENSMUST00000205131]
Predicted Effect probably benign
Transcript: ENSMUST00000009538
SMART Domains Protein: ENSMUSP00000009538
Gene: ENSMUSG00000009394

DomainStartEndE-ValueType
Pfam:Synapsin_N 2 33 3.4e-24 PFAM
Pfam:Synapsin 112 213 6.4e-48 PFAM
Pfam:Synapsin_C 215 417 8.2e-140 PFAM
low complexity region 450 470 N/A INTRINSIC
low complexity region 473 507 N/A INTRINSIC
low complexity region 524 540 N/A INTRINSIC
low complexity region 551 562 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000032462
SMART Domains Protein: ENSMUSP00000032462
Gene: ENSMUSG00000030317

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
NTR 30 207 1.85e-122 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166681
Predicted Effect probably benign
Transcript: ENSMUST00000169345
SMART Domains Protein: ENSMUSP00000133121
Gene: ENSMUSG00000009394

DomainStartEndE-ValueType
Pfam:Synapsin_N 2 33 1.3e-24 PFAM
Pfam:Synapsin 109 213 1.6e-62 PFAM
Pfam:Synapsin_C 215 417 4.4e-133 PFAM
Pfam:RimK 247 403 4.5e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203450
SMART Domains Protein: ENSMUSP00000144921
Gene: ENSMUSG00000009394

DomainStartEndE-ValueType
Pfam:Synapsin_N 2 33 2.7e-24 PFAM
Pfam:Synapsin 112 213 4.6e-48 PFAM
Pfam:Synapsin_C 215 417 5.3e-140 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203768
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204617
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204726
Predicted Effect probably benign
Transcript: ENSMUST00000205131
SMART Domains Protein: ENSMUSP00000144785
Gene: ENSMUSG00000030317

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
NTR 30 175 2.6e-76 SMART
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.7%
  • 10x: 96.2%
  • 20x: 94.0%
Validation Efficiency 97% (64/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the synapsin gene family. Synapsins encode neuronal phosphoproteins which associate with the cytoplasmic surface of synaptic vesicles. Family members are characterized by common protein domains, and they are implicated in synaptogenesis and the modulation of neurotransmitter release, suggesting a potential role in several neuropsychiatric diseases. This member of the synapsin family encodes a neuron-specific phosphoprotein that selectively binds to small synaptic vesicles in the presynaptic nerve terminal. Polymorphisms in this gene are associated with abnormal presynaptic function and related neuronal disorders, including autism, epilepsy, bipolar disorder and schizophrenia. Alternative splicing of this gene results in multiple transcript variants. The tissue inhibitor of metalloproteinase 4 gene is located within an intron of this gene and is transcribed in the opposite direction. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygous mutation of this gene results in central nervous system abnormalities. One model showed delayed synapse formation and decreased brain weight while another allele showed decreased post-tetanic potentiation and increased synaptic depression and development of convulsive seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A G 4: 53,046,105 F1721S probably damaging Het
Adgrb1 G A 15: 74,529,389 R78H probably damaging Het
Adgrd1 G A 5: 129,139,594 A342T probably benign Het
Adrb1 A T 19: 56,723,491 K374* probably null Het
Aldh18a1 C A 19: 40,573,789 V264F probably benign Het
Aldh1l2 C T 10: 83,522,687 probably benign Het
Alox15 T A 11: 70,346,153 H393L probably damaging Het
Aox2 A G 1: 58,339,446 probably benign Het
Appbp2 T C 11: 85,201,462 Y297C probably damaging Het
Atxn2l T G 7: 126,493,207 Q950P probably damaging Het
Bicd1 A T 6: 149,517,042 D737V probably damaging Het
C9 T C 15: 6,467,458 I212T probably benign Het
Ccdc63 A T 5: 122,117,044 probably benign Het
Chst1 C A 2: 92,613,606 P141Q probably damaging Het
Cped1 T A 6: 22,119,476 F311L probably damaging Het
D6Wsu163e T A 6: 126,946,491 H113Q probably benign Het
Dcn A T 10: 97,506,483 probably benign Het
Dmbx1 C T 4: 115,918,112 A324T probably benign Het
Dock10 G T 1: 80,512,454 Q1618K probably damaging Het
Dpyd A G 3: 118,917,272 E443G probably benign Het
Espl1 T C 15: 102,313,017 V953A possibly damaging Het
Exosc10 T C 4: 148,562,756 L174P probably damaging Het
Foxg1 A G 12: 49,385,582 Y366C probably damaging Het
Fxyd3 T C 7: 31,070,734 probably benign Het
Gbp2 T C 3: 142,630,106 V189A probably benign Het
Gins4 T C 8: 23,229,410 probably benign Het
Gm12789 A G 4: 101,988,122 T3A probably benign Het
Gnb1l T C 16: 18,548,089 probably benign Het
Gtpbp3 T C 8: 71,491,497 L295S probably damaging Het
Hrh4 C A 18: 13,022,398 Y331* probably null Het
Hsd11b1 A T 1: 193,241,397 Y52N probably damaging Het
Jam3 A G 9: 27,106,405 I29T probably benign Het
Kctd16 T A 18: 40,530,877 I353N probably benign Het
Lama4 G T 10: 39,028,639 G246C probably damaging Het
Lhx3 T A 2: 26,203,028 M137L probably benign Het
Morc2a T C 11: 3,678,567 I340T probably benign Het
Myo7a A C 7: 98,054,624 I1969S probably benign Het
Olfr1471 T A 19: 13,445,428 C139S probably damaging Het
Olfr304 T C 7: 86,386,267 E131G possibly damaging Het
Olfr429 A G 1: 174,089,166 N42S probably damaging Het
Pclo T C 5: 14,681,180 L3232P unknown Het
Polr1a T G 6: 71,974,139 I1407M probably damaging Het
Ppip5k2 A G 1: 97,728,997 V817A probably damaging Het
Rbfox3 T C 11: 118,495,240 T280A probably benign Het
Rfx3 T C 19: 27,793,788 D521G probably benign Het
Scn5a C T 9: 119,543,135 V223I probably damaging Het
Sgsm3 T G 15: 81,006,602 M119R probably damaging Het
Slc6a7 T A 18: 60,996,711 M608L probably benign Het
Slit2 A G 5: 48,182,331 probably benign Het
Steap2 T A 5: 5,673,561 I440F probably benign Het
Taar2 G A 10: 23,941,495 R311H probably benign Het
Tfb2m G A 1: 179,533,638 H262Y probably benign Het
Trmt1l A G 1: 151,457,675 probably benign Het
Trpm6 C A 19: 18,823,378 P819T probably benign Het
Ttn G A 2: 76,743,689 A25620V probably damaging Het
Ubn2 T C 6: 38,482,618 probably null Het
Vars T C 17: 35,011,596 probably benign Het
Vip A T 10: 5,644,004 D119V possibly damaging Het
Vmn2r92 C T 17: 18,167,957 A408V probably damaging Het
Vps33b T C 7: 80,286,054 I405T possibly damaging Het
Zbtb21 T A 16: 97,952,100 S356C probably damaging Het
Zdhhc6 A T 19: 55,308,930 S237T probably benign Het
Zfp142 G A 1: 74,576,064 A427V probably benign Het
Zfp692 T A 11: 58,314,314 V463E possibly damaging Het
Zmynd8 A T 2: 165,828,402 I384N probably damaging Het
Other mutations in Syn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03040:Syn2 APN 6 115263965 missense possibly damaging 0.92
IGL03328:Syn2 APN 6 115274260 missense probably damaging 0.97
R0044:Syn2 UTSW 6 115135147 missense unknown
R2026:Syn2 UTSW 6 115278251 missense probably benign 0.01
R2290:Syn2 UTSW 6 115274229 missense possibly damaging 0.91
R2900:Syn2 UTSW 6 115237334 missense possibly damaging 0.74
R3949:Syn2 UTSW 6 115227329 unclassified probably null
R3983:Syn2 UTSW 6 115237298 missense probably benign 0.01
R5101:Syn2 UTSW 6 115263899 missense probably damaging 1.00
R5502:Syn2 UTSW 6 115278352 missense possibly damaging 0.96
R6334:Syn2 UTSW 6 115263914 missense possibly damaging 0.92
R6546:Syn2 UTSW 6 115281098 missense probably benign 0.18
R6766:Syn2 UTSW 6 115239401 missense probably damaging 0.97
R7491:Syn2 UTSW 6 115254654 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- GGGTCTTGCCAGGGTTATCTAATGC -3'
(R):5'- CATGGCTGTCAAGAGACTTGGAGG -3'

Sequencing Primer
(F):5'- gctctgcttccagcctac -3'
(R):5'- CTTGGAGGGGAATCTACTAACATAG -3'
Posted On2013-05-09