Incidental Mutation 'R0321:Myo1f'
ID 35891
Institutional Source Beutler Lab
Gene Symbol Myo1f
Ensembl Gene ENSMUSG00000024300
Gene Name myosin IF
Synonyms C330006B10Rik
MMRRC Submission 038531-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.167) question?
Stock # R0321 (G1)
Quality Score 167
Status Validated
Chromosome 17
Chromosomal Location 33555719-33607764 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 33593012 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Alanine at position 595 (D595A)
Ref Sequence ENSEMBL: ENSMUSP00000084887 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087605] [ENSMUST00000173372]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000087605
AA Change: D595A

PolyPhen 2 Score 0.312 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000084887
Gene: ENSMUSG00000024300
AA Change: D595A

MYSc 11 691 N/A SMART
IQ 692 714 7.57e0 SMART
Pfam:Myosin_TH1 717 909 1.7e-51 PFAM
low complexity region 939 952 N/A INTRINSIC
low complexity region 973 987 N/A INTRINSIC
low complexity region 991 1001 N/A INTRINSIC
SH3 1044 1098 2.09e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173372
AA Change: D595A

PolyPhen 2 Score 0.225 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000134715
Gene: ENSMUSG00000024300
AA Change: D595A

MYSc 11 691 N/A SMART
IQ 692 714 7.57e0 SMART
Pfam:Myosin_TH1 716 780 6e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173426
Meta Mutation Damage Score 0.2651 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.7%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Myosins are molecular motors that use the energy from ATP hydrolysis to generate force on actin filaments. The protein encoded by this gene is an unconventional myosin that may be involved in the intracellular movement of membrane-enclosed compartments. There is evidence to suggest that mutations in this gene can result in hearing loss. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired neutrophil migration and adhesion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik T C 2: 151,472,700 T353A probably benign Het
4932438A13Rik T C 3: 36,906,788 probably null Het
4933402N03Rik T A 7: 131,146,227 Y12F probably benign Het
Acbd3 T G 1: 180,752,305 F505V probably damaging Het
Acod1 T C 14: 103,055,129 V363A probably benign Het
Adam28 T C 14: 68,617,751 Q647R probably damaging Het
Akr1c18 T A 13: 4,135,244 L296F probably damaging Het
Ap1b1 G A 11: 5,032,464 A588T probably benign Het
Armc8 A T 9: 99,533,177 I150K probably damaging Het
Bahcc1 T C 11: 120,273,425 probably null Het
Carmil3 C A 14: 55,502,241 D928E possibly damaging Het
Ccrl2 T C 9: 111,056,211 N73S probably damaging Het
Cdk9 C A 2: 32,712,686 probably benign Het
Cel G T 2: 28,561,148 Q66K probably benign Het
D930028M14Rik T A 7: 25,155,566 noncoding transcript Het
Dgka G C 10: 128,721,083 probably benign Het
Dlg1 T C 16: 31,858,036 V801A probably damaging Het
Dnah10 A G 5: 124,823,352 D3834G probably benign Het
Dnajc15 C T 14: 77,874,833 A23T possibly damaging Het
Ell2 T A 13: 75,761,888 L119Q probably damaging Het
Epha2 T C 4: 141,308,405 W51R probably damaging Het
F10 T C 8: 13,053,413 F266L possibly damaging Het
Fam110a T C 2: 151,970,667 N61S probably benign Het
Fam83c C T 2: 155,829,700 S605N probably benign Het
Fbxw15 C T 9: 109,565,385 V121I probably benign Het
Gart G A 16: 91,623,037 probably benign Het
Gfi1b A G 2: 28,613,885 F101S probably damaging Het
Gimap5 C G 6: 48,750,515 probably benign Het
Gpr180 T C 14: 118,148,287 probably null Het
Gsn T C 2: 35,290,396 F188L probably benign Het
Hivep3 T A 4: 120,095,591 I368N possibly damaging Het
Itih3 T A 14: 30,912,106 I153F probably damaging Het
Kdm8 A T 7: 125,461,006 Q360L probably damaging Het
Lars T C 18: 42,202,632 K1140E probably damaging Het
Mocs1 A G 17: 49,433,258 Y71C probably damaging Het
Mroh5 C T 15: 73,790,043 G433E probably damaging Het
Mrpl45 T A 11: 97,326,938 probably benign Het
Mtcl1 T A 17: 66,379,431 T827S probably damaging Het
Muc5b T C 7: 141,862,235 S2973P probably benign Het
Mynn T C 3: 30,607,557 S263P probably benign Het
Necab1 A T 4: 14,960,083 I288N probably damaging Het
Nutm2 T G 13: 50,472,955 M382R probably damaging Het
Oprm1 T C 10: 6,829,183 S131P probably damaging Het
Pcsk9 A G 4: 106,444,694 S619P probably benign Het
Phkg1 A T 5: 129,869,524 M1K probably null Het
Pigc C T 1: 161,971,099 Q217* probably null Het
Pik3r4 T A 9: 105,648,707 F259I probably damaging Het
Pkdcc A T 17: 83,222,112 probably benign Het
Pnpla5 G T 15: 84,120,719 L144M probably damaging Het
Prtg A T 9: 72,848,025 I259F possibly damaging Het
Prune2 T G 19: 17,120,927 L1265R possibly damaging Het
Prune2 C T 19: 17,122,454 A1774V probably benign Het
Rcn3 A G 7: 45,088,715 probably benign Het
Rnf213 C T 11: 119,438,105 Q2067* probably null Het
Sec14l1 T A 11: 117,150,742 probably benign Het
Serpinb3a C T 1: 107,047,482 W198* probably null Het
Smpdl3b A T 4: 132,741,444 V154E probably damaging Het
Spag17 T C 3: 100,101,403 S1950P probably damaging Het
Sprr1a T C 3: 92,484,302 T131A probably benign Het
Tatdn2 T G 6: 113,709,501 L690W probably damaging Het
Tbc1d1 T C 5: 64,339,594 F864L probably damaging Het
Tmem8b C A 4: 43,674,444 R243S probably damaging Het
Tnfrsf11a T A 1: 105,844,857 C623* probably null Het
Tprgl T C 4: 154,159,355 N115D probably damaging Het
Ube2t C T 1: 134,967,800 A4V possibly damaging Het
Vps41 G A 13: 18,842,295 probably benign Het
Wdr17 C T 8: 54,696,268 probably null Het
Wwc1 G A 11: 35,841,810 Q1024* probably null Het
Zfand5 T A 19: 21,276,515 N27K probably damaging Het
Zfp142 A T 1: 74,569,714 C1641S probably damaging Het
Zfyve16 A G 13: 92,492,534 I1465T probably damaging Het
Zswim1 G A 2: 164,826,027 G400S probably benign Het
Zswim3 C T 2: 164,820,359 A253V possibly damaging Het
Other mutations in Myo1f
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00851:Myo1f APN 17 33581964 missense probably benign 0.01
IGL01019:Myo1f APN 17 33593003 missense possibly damaging 0.93
IGL01524:Myo1f APN 17 33579883 missense probably damaging 1.00
IGL01744:Myo1f APN 17 33583680 splice site probably benign
IGL01951:Myo1f APN 17 33598017 missense possibly damaging 0.64
IGL02132:Myo1f APN 17 33579971 missense probably benign 0.10
IGL02170:Myo1f APN 17 33578272 missense probably benign 0.14
IGL02173:Myo1f APN 17 33607344 missense probably damaging 1.00
IGL02277:Myo1f APN 17 33579861 splice site probably null
IGL02550:Myo1f APN 17 33588142 missense probably damaging 1.00
IGL02550:Myo1f APN 17 33580150 unclassified probably benign
IGL02615:Myo1f APN 17 33604656 missense probably benign
IGL02801:Myo1f APN 17 33578137 missense probably damaging 1.00
IGL02817:Myo1f APN 17 33604558 missense probably benign 0.06
IGL02904:Myo1f APN 17 33585658 nonsense probably null
IGL03056:Myo1f APN 17 33585600 missense probably damaging 1.00
IGL03334:Myo1f APN 17 33598194 missense probably damaging 1.00
R0066:Myo1f UTSW 17 33601703 missense probably damaging 0.98
R0066:Myo1f UTSW 17 33601703 missense probably damaging 0.98
R0375:Myo1f UTSW 17 33601956 missense probably benign 0.27
R0487:Myo1f UTSW 17 33578284 missense probably damaging 1.00
R0925:Myo1f UTSW 17 33578133 missense probably damaging 0.96
R1394:Myo1f UTSW 17 33583740 missense probably damaging 0.96
R1395:Myo1f UTSW 17 33583740 missense probably damaging 0.96
R1474:Myo1f UTSW 17 33594027 missense possibly damaging 0.77
R1760:Myo1f UTSW 17 33586198 missense probably benign 0.03
R1965:Myo1f UTSW 17 33598172 nonsense probably null
R2409:Myo1f UTSW 17 33576667 missense probably damaging 1.00
R2432:Myo1f UTSW 17 33575849 missense probably damaging 1.00
R4610:Myo1f UTSW 17 33582332 missense probably damaging 1.00
R4785:Myo1f UTSW 17 33598191 missense possibly damaging 0.95
R5239:Myo1f UTSW 17 33601735 missense probably benign 0.00
R5881:Myo1f UTSW 17 33576653 missense probably damaging 1.00
R5881:Myo1f UTSW 17 33580285 missense possibly damaging 0.46
R6160:Myo1f UTSW 17 33604344 missense probably benign
R6210:Myo1f UTSW 17 33601070 missense probably damaging 1.00
R6365:Myo1f UTSW 17 33586116 missense probably benign
R6464:Myo1f UTSW 17 33576647 missense probably damaging 1.00
R6532:Myo1f UTSW 17 33575846 missense probably damaging 1.00
R6678:Myo1f UTSW 17 33575845 missense probably damaging 1.00
R7241:Myo1f UTSW 17 33579928 missense probably damaging 0.99
R7266:Myo1f UTSW 17 33601694 missense probably benign
R7513:Myo1f UTSW 17 33575814 missense probably damaging 1.00
R7606:Myo1f UTSW 17 33576450 missense probably damaging 1.00
R7779:Myo1f UTSW 17 33578273 missense probably benign 0.27
R7853:Myo1f UTSW 17 33576698 missense probably damaging 1.00
R7884:Myo1f UTSW 17 33598296 missense probably damaging 1.00
R8507:Myo1f UTSW 17 33598018 missense probably benign 0.09
R8807:Myo1f UTSW 17 33575905 missense probably damaging 1.00
R9009:Myo1f UTSW 17 33604688 missense probably benign 0.12
R9083:Myo1f UTSW 17 33594062 missense probably damaging 0.99
R9227:Myo1f UTSW 17 33576450 missense probably damaging 1.00
R9230:Myo1f UTSW 17 33576450 missense probably damaging 1.00
R9528:Myo1f UTSW 17 33578182 critical splice donor site probably null
X0028:Myo1f UTSW 17 33576438 missense possibly damaging 0.67
X0065:Myo1f UTSW 17 33601983 missense probably benign
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- tggagcccaaaggattgaac -3'
Posted On 2013-05-09