Incidental Mutation 'R4769:Dpy19l1'
ID366344
Institutional Source Beutler Lab
Gene Symbol Dpy19l1
Ensembl Gene ENSMUSG00000043067
Gene Namedpy-19-like 1 (C. elegans)
Synonyms1100001I19Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.152) question?
Stock #R4769 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location24411776-24503140 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 24426148 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 517 (F517I)
Ref Sequence ENSEMBL: ENSMUSP00000129575 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115277] [ENSMUST00000142064] [ENSMUST00000170356]
Predicted Effect probably damaging
Transcript: ENSMUST00000115277
AA Change: F323I

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000110932
Gene: ENSMUSG00000043067
AA Change: F323I

DomainStartEndE-ValueType
Pfam:Dpy19 10 549 1.6e-212 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000142064
AA Change: F517I

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000119986
Gene: ENSMUSG00000043067
AA Change: F517I

DomainStartEndE-ValueType
low complexity region 12 26 N/A INTRINSIC
low complexity region 42 69 N/A INTRINSIC
Pfam:Dpy19 99 743 2e-247 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149001
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152480
Predicted Effect probably damaging
Transcript: ENSMUST00000170356
AA Change: F517I

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000129575
Gene: ENSMUSG00000043067
AA Change: F517I

DomainStartEndE-ValueType
low complexity region 12 26 N/A INTRINSIC
low complexity region 42 69 N/A INTRINSIC
Pfam:Dpy19 98 743 5.5e-264 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A C 14: 32,660,217 S1264A probably benign Het
Adamts13 T G 2: 27,008,711 Y1361* probably null Het
Ahrr A T 13: 74,214,212 D389E probably damaging Het
Alx3 T C 3: 107,600,691 F172S probably damaging Het
Antxrl A G 14: 34,073,070 H485R possibly damaging Het
Aox4 A G 1: 58,259,148 D1091G probably null Het
Btbd1 T A 7: 81,805,810 Q271L probably benign Het
Cd209c A T 8: 3,944,953 N70K probably benign Het
Cdc14a C T 3: 116,294,750 probably null Het
Cenpe A G 3: 135,248,151 M1641V probably benign Het
Clec2e G A 6: 129,100,827 T16I probably benign Het
Clp1 T C 2: 84,725,875 D87G possibly damaging Het
Dzip3 T C 16: 48,938,474 N646S probably damaging Het
Ephx1 T A 1: 180,995,978 Y188F possibly damaging Het
Etfa A T 9: 55,495,767 H81Q possibly damaging Het
Gigyf2 T A 1: 87,440,849 F1084I probably damaging Het
Heatr3 T C 8: 88,141,783 probably null Het
Ift81 G T 5: 122,594,593 H293N probably benign Het
Igkv9-120 G T 6: 68,050,367 R88S possibly damaging Het
Il6 T G 5: 30,018,078 L114* probably null Het
Ism2 A T 12: 87,299,581 M42K probably benign Het
Lhx5 A G 5: 120,436,438 E269G probably benign Het
Marveld1 T G 19: 42,147,995 M116R possibly damaging Het
Micall2 A G 5: 139,706,886 S911P probably damaging Het
Mier1 G A 4: 103,140,220 R195H probably benign Het
Muc2 T A 7: 141,699,691 probably null Het
Mybbp1a A G 11: 72,445,640 K486R probably damaging Het
Ncapd2 A C 6: 125,185,745 L179R probably damaging Het
Nos1 C T 5: 117,943,245 Q1171* probably null Het
Nrg1 T A 8: 31,917,972 I78F probably damaging Het
Olfr1163 T G 2: 88,070,729 T218P probably benign Het
Olfr220 T G 1: 174,448,958 F112V possibly damaging Het
Plek2 C T 12: 78,906,890 probably null Het
Plod2 A G 9: 92,595,272 H339R probably damaging Het
Pold1 C T 7: 44,535,071 C835Y probably damaging Het
Polr1a A G 6: 71,950,868 I868V probably benign Het
Prss54 C A 8: 95,559,375 V357L probably benign Het
Rbbp8 T A 18: 11,722,670 S625T probably damaging Het
Rgs1 A T 1: 144,247,929 L86Q probably damaging Het
Ripk4 T A 16: 97,744,062 N462Y probably damaging Het
Rsf1 C T 7: 97,676,222 L1011F probably damaging Het
Slc19a3 G A 1: 83,019,341 T382I probably damaging Het
Slc9a2 G A 1: 40,726,374 R308Q probably damaging Het
Top2b T A 14: 16,398,991 L537Q probably damaging Het
Trim45 C A 3: 100,931,734 probably benign Het
Umodl1 G T 17: 30,984,002 R443M possibly damaging Het
Vmn1r11 G A 6: 57,137,612 R87K probably damaging Het
Vmn1r78 T A 7: 12,152,798 I112N probably damaging Het
Zeb2 T G 2: 44,996,435 E825A probably damaging Het
Zfp930 A T 8: 69,226,692 I50F probably benign Het
Other mutations in Dpy19l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:Dpy19l1 APN 9 24481930 missense probably damaging 0.99
IGL00788:Dpy19l1 APN 9 24462568 splice site probably benign
IGL00959:Dpy19l1 APN 9 24423197 splice site probably null
IGL01646:Dpy19l1 APN 9 24485069 missense probably damaging 0.99
IGL01647:Dpy19l1 APN 9 24485069 missense probably damaging 0.99
IGL01713:Dpy19l1 APN 9 24485069 missense probably damaging 0.99
IGL01715:Dpy19l1 APN 9 24485069 missense probably damaging 0.99
IGL01743:Dpy19l1 APN 9 24485069 missense probably damaging 0.99
IGL01912:Dpy19l1 APN 9 24485069 missense probably damaging 0.99
IGL02417:Dpy19l1 APN 9 24475386 missense possibly damaging 0.48
IGL02629:Dpy19l1 APN 9 24438713 splice site probably benign
IGL02677:Dpy19l1 APN 9 24485072 missense probably damaging 1.00
IGL02949:Dpy19l1 APN 9 24421180 missense probably benign 0.44
IGL03067:Dpy19l1 APN 9 24438660 missense probably benign 0.00
R0066:Dpy19l1 UTSW 9 24414409 missense possibly damaging 0.95
R0207:Dpy19l1 UTSW 9 24453891 missense probably damaging 1.00
R0462:Dpy19l1 UTSW 9 24414349 missense probably benign 0.01
R0544:Dpy19l1 UTSW 9 24485110 splice site probably benign
R0749:Dpy19l1 UTSW 9 24462584 missense probably benign 0.35
R0838:Dpy19l1 UTSW 9 24432431 missense probably damaging 0.98
R1114:Dpy19l1 UTSW 9 24424776 missense probably benign 0.30
R1546:Dpy19l1 UTSW 9 24475384 missense probably damaging 0.98
R1767:Dpy19l1 UTSW 9 24462584 missense probably benign 0.35
R1926:Dpy19l1 UTSW 9 24473824 missense probably benign
R1933:Dpy19l1 UTSW 9 24434387 missense probably damaging 0.99
R2046:Dpy19l1 UTSW 9 24423159 missense probably damaging 0.98
R2101:Dpy19l1 UTSW 9 24482035 missense probably damaging 0.99
R4083:Dpy19l1 UTSW 9 24485048 missense possibly damaging 0.86
R4565:Dpy19l1 UTSW 9 24432388 missense probably null 1.00
R4649:Dpy19l1 UTSW 9 24482054 missense possibly damaging 0.94
R4652:Dpy19l1 UTSW 9 24482054 missense possibly damaging 0.94
R4653:Dpy19l1 UTSW 9 24482054 missense possibly damaging 0.94
R4669:Dpy19l1 UTSW 9 24432368 missense possibly damaging 0.94
R4746:Dpy19l1 UTSW 9 24450670 missense probably benign 0.29
R4785:Dpy19l1 UTSW 9 24424823 missense probably damaging 1.00
R5177:Dpy19l1 UTSW 9 24438628 critical splice donor site probably null
R5466:Dpy19l1 UTSW 9 24414388 missense probably damaging 0.99
R5707:Dpy19l1 UTSW 9 24414267 makesense probably null
R6265:Dpy19l1 UTSW 9 24432371 missense possibly damaging 0.88
R6266:Dpy19l1 UTSW 9 24439146 missense probably damaging 0.99
R6290:Dpy19l1 UTSW 9 24462600 missense probably damaging 1.00
R6380:Dpy19l1 UTSW 9 24482045 nonsense probably null
R6478:Dpy19l1 UTSW 9 24450696 missense possibly damaging 0.88
R6581:Dpy19l1 UTSW 9 24447864 missense possibly damaging 0.68
R6756:Dpy19l1 UTSW 9 24473784 missense probably damaging 0.99
R6773:Dpy19l1 UTSW 9 24440772 missense probably damaging 0.97
R6795:Dpy19l1 UTSW 9 24502862 missense possibly damaging 0.53
R6796:Dpy19l1 UTSW 9 24502862 missense possibly damaging 0.53
R7060:Dpy19l1 UTSW 9 24423123 missense possibly damaging 0.88
X0025:Dpy19l1 UTSW 9 24432380 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCCAATCAGCTTGCTCATTC -3'
(R):5'- CCTAGTCAGATGCACACAGC -3'

Sequencing Primer
(F):5'- TCAGCTTGCTCATTCCTACAAAAAG -3'
(R):5'- GTCAGTGGAGTACCTCG -3'
Posted On2015-12-21