Incidental Mutation 'R4769:Ism2'
ID366351
Institutional Source Beutler Lab
Gene Symbol Ism2
Ensembl Gene ENSMUSG00000050671
Gene Nameisthmin 2
SynonymsThsd3, LOC217738
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4769 (G1)
Quality Score179
Status Not validated
Chromosome12
Chromosomal Location87278638-87299705 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 87299581 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 42 (M42K)
Ref Sequence ENSEMBL: ENSMUSP00000117108 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000125733]
Predicted Effect probably benign
Transcript: ENSMUST00000125733
AA Change: M42K

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000117108
Gene: ENSMUSG00000050671
AA Change: M42K

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
low complexity region 96 112 N/A INTRINSIC
TSP1 250 292 3.9e-7 SMART
AMOP 317 481 1.21e-75 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A C 14: 32,660,217 S1264A probably benign Het
Adamts13 T G 2: 27,008,711 Y1361* probably null Het
Ahrr A T 13: 74,214,212 D389E probably damaging Het
Alx3 T C 3: 107,600,691 F172S probably damaging Het
Antxrl A G 14: 34,073,070 H485R possibly damaging Het
Aox4 A G 1: 58,259,148 D1091G probably null Het
Btbd1 T A 7: 81,805,810 Q271L probably benign Het
Cd209c A T 8: 3,944,953 N70K probably benign Het
Cdc14a C T 3: 116,294,750 probably null Het
Cenpe A G 3: 135,248,151 M1641V probably benign Het
Clec2e G A 6: 129,100,827 T16I probably benign Het
Clp1 T C 2: 84,725,875 D87G possibly damaging Het
Dpy19l1 A T 9: 24,426,148 F517I probably damaging Het
Dzip3 T C 16: 48,938,474 N646S probably damaging Het
Ephx1 T A 1: 180,995,978 Y188F possibly damaging Het
Etfa A T 9: 55,495,767 H81Q possibly damaging Het
Gigyf2 T A 1: 87,440,849 F1084I probably damaging Het
Heatr3 T C 8: 88,141,783 probably null Het
Ift81 G T 5: 122,594,593 H293N probably benign Het
Igkv9-120 G T 6: 68,050,367 R88S possibly damaging Het
Il6 T G 5: 30,018,078 L114* probably null Het
Lhx5 A G 5: 120,436,438 E269G probably benign Het
Marveld1 T G 19: 42,147,995 M116R possibly damaging Het
Micall2 A G 5: 139,706,886 S911P probably damaging Het
Mier1 G A 4: 103,140,220 R195H probably benign Het
Muc2 T A 7: 141,699,691 probably null Het
Mybbp1a A G 11: 72,445,640 K486R probably damaging Het
Ncapd2 A C 6: 125,185,745 L179R probably damaging Het
Nos1 C T 5: 117,943,245 Q1171* probably null Het
Nrg1 T A 8: 31,917,972 I78F probably damaging Het
Olfr1163 T G 2: 88,070,729 T218P probably benign Het
Olfr220 T G 1: 174,448,958 F112V possibly damaging Het
Plek2 C T 12: 78,906,890 probably null Het
Plod2 A G 9: 92,595,272 H339R probably damaging Het
Pold1 C T 7: 44,535,071 C835Y probably damaging Het
Polr1a A G 6: 71,950,868 I868V probably benign Het
Prss54 C A 8: 95,559,375 V357L probably benign Het
Rbbp8 T A 18: 11,722,670 S625T probably damaging Het
Rgs1 A T 1: 144,247,929 L86Q probably damaging Het
Ripk4 T A 16: 97,744,062 N462Y probably damaging Het
Rsf1 C T 7: 97,676,222 L1011F probably damaging Het
Slc19a3 G A 1: 83,019,341 T382I probably damaging Het
Slc9a2 G A 1: 40,726,374 R308Q probably damaging Het
Top2b T A 14: 16,398,991 L537Q probably damaging Het
Trim45 C A 3: 100,931,734 probably benign Het
Umodl1 G T 17: 30,984,002 R443M possibly damaging Het
Vmn1r11 G A 6: 57,137,612 R87K probably damaging Het
Vmn1r78 T A 7: 12,152,798 I112N probably damaging Het
Zeb2 T G 2: 44,996,435 E825A probably damaging Het
Zfp930 A T 8: 69,226,692 I50F probably benign Het
Other mutations in Ism2
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4243001:Ism2 UTSW 12 87287058 missense probably benign 0.00
R0544:Ism2 UTSW 12 87285339 missense probably damaging 1.00
R0747:Ism2 UTSW 12 87285398 splice site probably benign
R2258:Ism2 UTSW 12 87280074 missense possibly damaging 0.92
R2859:Ism2 UTSW 12 87299663 missense unknown
R3423:Ism2 UTSW 12 87287097 missense probably benign 0.00
R3425:Ism2 UTSW 12 87287097 missense probably benign 0.00
R4115:Ism2 UTSW 12 87287031 missense probably benign 0.02
R4713:Ism2 UTSW 12 87285027 splice site silent
R5313:Ism2 UTSW 12 87279762 missense probably damaging 1.00
R5857:Ism2 UTSW 12 87280061 missense probably damaging 1.00
R5984:Ism2 UTSW 12 87287035 missense possibly damaging 0.77
R6389:Ism2 UTSW 12 87282371 missense possibly damaging 0.49
R6838:Ism2 UTSW 12 87280201 missense probably benign 0.23
R7019:Ism2 UTSW 12 87299663 missense unknown
R7358:Ism2 UTSW 12 87280040 missense probably damaging 1.00
R7427:Ism2 UTSW 12 87286995 missense possibly damaging 0.76
R7428:Ism2 UTSW 12 87286995 missense possibly damaging 0.76
R7777:Ism2 UTSW 12 87286884 splice site probably null
R7824:Ism2 UTSW 12 87279860 missense probably damaging 1.00
Z1177:Ism2 UTSW 12 87280035 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCAGGTGATGTTCGCTCAG -3'
(R):5'- TTTCCCGGGACAGGAATTC -3'

Sequencing Primer
(F):5'- TAGGACCCAAGAAGCCGG -3'
(R):5'- ACAGGAATTCGCTTGGGGC -3'
Posted On2015-12-21