Mutagenetix > Incidental Mutation

Incidental Mutation 'R4887:Stxbp5'

376991

Institutional Source

Beutler Lab

Gene Symbol

Stxbp5

Ensembl Gene

ENSMUSG00000019790

Gene Name

syntaxin binding protein 5 (tomosyn)

Synonyms

4930565N16Rik, 0710001E20Rik, LGL3, tomosyn 1

MMRRC Submission

041979-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4887 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

9755547-9901079 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 9809100 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 519 (I519V)

Ref Sequence

ENSEMBL: ENSMUSP00000123253 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038213] [ENSMUST00000125200] [ENSMUST00000141722]

AlphaFold

Q8K400

Predicted Effect

probably benign
Transcript: ENSMUST00000038213
AA Change: I519V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000044535
Gene: ENSMUSG00000019790
AA Change: I519V

Domain	Start	End	E-Value	Type
low complexity region	17	28	N/A	INTRINSIC
WD40	46	86	2.21e1	SMART
WD40	88	127	5.94e0	SMART
WD40	132	171	1.97e2	SMART
WD40	185	225	1.99e0	SMART
WD40	228	266	5.69e-4	SMART
Pfam:LLGL	276	385	2e-36	PFAM
WD40	386	465	2.88e-1	SMART
WD40	491	530	3.68e1	SMART
low complexity region	572	591	N/A	INTRINSIC
low complexity region	713	724	N/A	INTRINSIC
Pfam:Lgl_C	771	1050	2.7e-8	PFAM
PDB:1URQ\|A	1086	1145	2e-33	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000125200
AA Change: I519V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000121507
Gene: ENSMUSG00000019790
AA Change: I519V

Domain	Start	End	E-Value	Type
low complexity region	17	28	N/A	INTRINSIC
WD40	46	86	2.21e1	SMART
WD40	88	127	5.94e0	SMART
WD40	132	171	1.97e2	SMART
WD40	185	225	1.99e0	SMART
WD40	228	266	5.69e-4	SMART
Pfam:LLGL	273	385	1.6e-46	PFAM
WD40	386	465	2.88e-1	SMART
WD40	491	530	3.68e1	SMART
low complexity region	572	591	N/A	INTRINSIC
low complexity region	722	730	N/A	INTRINSIC
Pfam:Lgl_C	839	994	1.9e-8	PFAM
PDB:1URQ\|A	1033	1092	2e-33	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000141722
AA Change: I519V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000123253
Gene: ENSMUSG00000019790
AA Change: I519V

Domain	Start	End	E-Value	Type
low complexity region	17	28	N/A	INTRINSIC
WD40	46	86	2.21e1	SMART
WD40	88	127	5.94e0	SMART
WD40	132	171	1.97e2	SMART
WD40	185	225	1.99e0	SMART
WD40	228	266	5.69e-4	SMART
Pfam:LLGL	273	385	1.7e-46	PFAM
WD40	386	465	2.88e-1	SMART
WD40	491	530	3.68e1	SMART
low complexity region	572	591	N/A	INTRINSIC
low complexity region	739	747	N/A	INTRINSIC
Pfam:Lgl_C	856	1011	2e-8	PFAM
PDB:1URQ\|A	1050	1109	2e-33	PDB

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Syntaxin 1 is a component of the 7S and 20S SNARE complexes which are involved in docking and fusion of synaptic vesicles with the presynaptic plasma membrane. This gene encodes a syntaxin 1 binding protein. In rat, a similar protein dissociates syntaxin 1 from the Munc18/n-Sec1/rbSec1 complex to form a 10S complex, an intermediate which can be converted to the 7S SNARE complex. Thus this protein is thought to be involved in neurotransmitter release by stimulating SNARE complex formation. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit some background sensitive prenatal lethality and increased synaptic transmission. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 94 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700061G19Rik	A	T	17: 56,876,324	I22F	possibly damaging	Het
2310009B15Rik	A	C	1: 138,852,165	Y116*	probably null	Het
4930548H24Rik	A	G	5: 31,486,252	I109V	probably benign	Het
Acer3	T	C	7: 98,257,701	T91A	possibly damaging	Het
Adam12	T	C	7: 134,172,821	K20E	possibly damaging	Het
Adamtsl3	T	C	7: 82,574,614	V275A	possibly damaging	Het
Afg1l	C	T	10: 42,454,378	V98I	probably benign	Het
Alpk1	C	T	3: 127,673,475	G1052R	probably damaging	Het
Anln	A	T	9: 22,380,188	S115T	possibly damaging	Het
Apob	T	A	12: 8,013,099	N3827K	probably damaging	Het
Aqr	G	A	2: 114,150,509	L264F	probably damaging	Het
Arhgap33	T	C	7: 30,532,192	S123G	probably damaging	Het
Arvcf	C	T	16: 18,398,113	R333*	probably null	Het
Brca2	T	A	5: 150,556,937	L2724Q	probably damaging	Het
Btbd11	C	T	10: 85,387,378	T17M	unknown	Het
C2cd6	T	A	1: 59,094,734	T43S	probably benign	Het
Cacna1h	A	G	17: 25,377,287	V1920A	possibly damaging	Het
Capsl	A	T	15: 9,457,772	I26F	possibly damaging	Het
Card10	A	T	15: 78,781,524	V673E	possibly damaging	Het
Ccar1	A	G	10: 62,753,218	S829P	unknown	Het
Cdc42bpa	T	C	1: 180,144,635	M1334T	possibly damaging	Het
Ceacam2	C	T	7: 25,520,832	C267Y	probably benign	Het
Cep68	G	A	11: 20,239,239	T591M	probably benign	Het
Chil4	T	C	3: 106,204,144	K218R	probably benign	Het
Cldn14	G	T	16: 93,919,859	T33K	possibly damaging	Het
Copa	T	A	1: 172,092,276	C140S	probably benign	Het
Coq6	T	C	12: 84,372,296	L358P	probably damaging	Het
Cyfip1	C	T	7: 55,872,068	P40L	probably damaging	Het
Dennd2a	A	C	6: 39,497,159	S414A	probably benign	Het
Dpm1	T	C	2: 168,217,759	N139S	probably benign	Het
Dpp7	T	A	2: 25,352,758		probably null	Het
Ednrb	T	C	14: 103,820,011	I372V	possibly damaging	Het
Edrf1	G	T	7: 133,658,610	M83I	probably damaging	Het
Fam135a	G	A	1: 24,024,253	Q1087*	probably null	Het
Fancg	T	C	4: 43,006,866	T275A	probably benign	Het
Fbn1	T	A	2: 125,309,774	H2520L	probably damaging	Het
Fmn2	T	C	1: 174,581,961	S587P	unknown	Het
Foxr2	A	G	X: 153,130,316	Q61R	probably damaging	Het
Frrs1	A	G	3: 116,902,416	*124W	probably null	Het
Gm16432	A	G	1: 178,103,949	Y478C	unknown	Het
Gm7535	T	A	17: 17,911,071		probably benign	Het
Gm884	T	C	11: 103,614,872	H2090R	probably benign	Het
Gm996	G	A	2: 25,579,747	R51C	possibly damaging	Het
Herc3	T	C	6: 58,887,499	V706A	probably damaging	Het
Hist1h4a	T	C	13: 23,760,952	D69G	probably damaging	Het
Hivep3	A	G	4: 120,122,934	E1723G	probably damaging	Het
Igsf9b	A	G	9: 27,322,650	I382V	probably benign	Het
Ints1	G	T	5: 139,771,156	T467N	possibly damaging	Het
Iqca	G	A	1: 90,045,701	T783M	probably damaging	Het
Kng1	A	G	16: 23,067,698	K131R	possibly damaging	Het
Krt35	T	C	11: 100,093,130	Y348C	probably damaging	Het
Ldlrad3	A	G	2: 102,113,536	C64R	probably damaging	Het
Lilr4b	C	T	10: 51,484,520	A272V	possibly damaging	Het
Ltn1	A	T	16: 87,398,809	C1276*	probably null	Het
Matn1	G	A	4: 130,952,114	A360T	probably benign	Het
Minpp1	G	A	19: 32,498,384	V306I	probably benign	Het
Mkx	G	A	18: 6,992,904	R127W	probably damaging	Het
Mrpl48	G	T	7: 100,546,409		probably benign	Het
Ms4a2	A	G	19: 11,618,429	L166S	possibly damaging	Het
Mtus2	T	A	5: 148,077,103	Y235*	probably null	Het
Myh4	G	T	11: 67,241,054	W113C	probably damaging	Het
Nav2	T	A	7: 49,548,434	C1270*	probably null	Het
Ncoa5	A	G	2: 165,002,150	L111P	probably damaging	Het
Nup107	T	C	10: 117,770,478	Y453C	probably damaging	Het
Oca2	C	T	7: 56,330,358	Q604*	probably null	Het
Olfr116	A	T	17: 37,623,891	V248D	probably damaging	Het
Olfr1339	A	C	4: 118,734,688	H53P	probably benign	Het
Olfr482	T	A	7: 108,095,096	N158I	probably benign	Het
Olfr525	T	C	7: 140,323,101	M134T	probably benign	Het
Olfr952	T	C	9: 39,426,235	T279A	possibly damaging	Het
Pde3a	G	T	6: 141,470,942	G514V	possibly damaging	Het
Pik3cb	A	T	9: 99,101,328	C76S	probably damaging	Het
Plk1	T	C	7: 122,168,605	V411A	probably damaging	Het
Pole	C	T	5: 110,324,753	P1600L	probably damaging	Het
Prr36	T	C	8: 4,210,881	T979A	probably benign	Het
Rdh7	T	A	10: 127,885,721	T229S	probably benign	Het
Rnpepl1	A	T	1: 92,915,113	T140S	probably damaging	Het
Rps6kc1	A	T	1: 190,798,694	S947T	probably benign	Het
Rtl1	A	G	12: 109,591,704	F1234L	probably damaging	Het
Sdc1	G	A	12: 8,791,708	M279I	probably damaging	Het
Siae	T	C	9: 37,627,800	L169P	possibly damaging	Het
Slc22a22	C	T	15: 57,249,752	V364I	probably benign	Het
Sltm	G	T	9: 70,588,978	V932F	probably damaging	Het
Smad1	A	G	8: 79,349,752	L279P	probably damaging	Het
Spag17	G	T	3: 100,050,831	G935V	probably damaging	Het
Srgap3	A	G	6: 112,746,934	S546P	probably damaging	Het
Syt16	A	T	12: 74,129,386	I10F	probably damaging	Het
Trim43b	C	G	9: 89,091,312	G123R	probably damaging	Het
Ubr3	T	C	2: 70,013,131	Y1572H	probably damaging	Het
Umodl1	G	A	17: 31,008,665	R1324H	probably benign	Het
Vmn2r44	A	T	7: 8,377,986	W303R	probably benign	Het
Wdr93	T	C	7: 79,785,774	Y684H	probably damaging	Het
Wnk2	G	A	13: 49,071,002	R268C	probably damaging	Het
Zfp438	C	T	18: 5,213,776	C394Y	possibly damaging	Het

Other mutations in Stxbp5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00466:Stxbp5	APN	10	9799950	missense	probably damaging	1.00
IGL00950:Stxbp5	APN	10	9808602	splice site	probably benign
IGL01725:Stxbp5	APN	10	9817411	missense	probably damaging	1.00
IGL02150:Stxbp5	APN	10	9762821	missense	probably damaging	1.00
IGL02339:Stxbp5	APN	10	9816297	missense	possibly damaging	0.89
IGL02697:Stxbp5	APN	10	9762956	nonsense	probably null
IGL02720:Stxbp5	APN	10	9789361	critical splice donor site	probably null
IGL03155:Stxbp5	APN	10	9816290	missense	probably null	1.00
IGL03288:Stxbp5	APN	10	9866703	splice site	probably null
Fatty_fish	UTSW	10	9770551	missense	probably damaging	1.00
reindeer	UTSW	10	9838092	missense	probably damaging	1.00
H8562:Stxbp5	UTSW	10	9769443	missense	probably benign	0.36
PIT4544001:Stxbp5	UTSW	10	9817304	critical splice donor site	probably null
R0025:Stxbp5	UTSW	10	9762748	missense	probably damaging	1.00
R0025:Stxbp5	UTSW	10	9762748	missense	probably damaging	1.00
R0219:Stxbp5	UTSW	10	9770528	missense	probably benign	0.36
R0226:Stxbp5	UTSW	10	9866698	splice site	probably benign
R0631:Stxbp5	UTSW	10	9784358	missense	probably benign
R0723:Stxbp5	UTSW	10	9768873	missense	probably damaging	1.00
R0833:Stxbp5	UTSW	10	9865099	missense	probably damaging	1.00
R0836:Stxbp5	UTSW	10	9865099	missense	probably damaging	1.00
R0863:Stxbp5	UTSW	10	9809040	missense	possibly damaging	0.86
R1225:Stxbp5	UTSW	10	9812391	missense	possibly damaging	0.94
R1271:Stxbp5	UTSW	10	9816269	missense	probably damaging	1.00
R1536:Stxbp5	UTSW	10	9838092	missense	probably damaging	1.00
R1852:Stxbp5	UTSW	10	9812298	missense	possibly damaging	0.94
R1884:Stxbp5	UTSW	10	9812298	missense	possibly damaging	0.94
R1902:Stxbp5	UTSW	10	9812298	missense	possibly damaging	0.94
R1917:Stxbp5	UTSW	10	9812298	missense	possibly damaging	0.94
R1918:Stxbp5	UTSW	10	9812298	missense	possibly damaging	0.94
R2174:Stxbp5	UTSW	10	9835846	missense	possibly damaging	0.69
R3773:Stxbp5	UTSW	10	9768927	missense	probably damaging	1.00
R3901:Stxbp5	UTSW	10	9769419	missense	probably damaging	1.00
R3981:Stxbp5	UTSW	10	9789316	intron	probably benign
R4572:Stxbp5	UTSW	10	9838144	missense	probably damaging	0.99
R4764:Stxbp5	UTSW	10	9770623	missense	probably damaging	1.00
R4841:Stxbp5	UTSW	10	9762891	missense	probably benign	0.06
R4842:Stxbp5	UTSW	10	9762891	missense	probably benign	0.06
R4884:Stxbp5	UTSW	10	9812341	nonsense	probably null
R4930:Stxbp5	UTSW	10	9760866	utr 3 prime	probably benign
R5065:Stxbp5	UTSW	10	9770551	missense	probably damaging	1.00
R5285:Stxbp5	UTSW	10	9798275	critical splice acceptor site	probably null
R5306:Stxbp5	UTSW	10	9799991	missense	probably damaging	1.00
R5455:Stxbp5	UTSW	10	9808508	missense	probably benign
R5531:Stxbp5	UTSW	10	9762924	nonsense	probably null
R5605:Stxbp5	UTSW	10	9769746	intron	probably benign
R5614:Stxbp5	UTSW	10	9760894	utr 3 prime	probably benign
R5805:Stxbp5	UTSW	10	9900586	missense	probably benign
R5990:Stxbp5	UTSW	10	9835933	missense	probably damaging	1.00
R6025:Stxbp5	UTSW	10	9800028	missense	probably benign	0.00
R6056:Stxbp5	UTSW	10	9770686	missense	probably benign	0.00
R6147:Stxbp5	UTSW	10	9808472	missense	possibly damaging	0.93
R6194:Stxbp5	UTSW	10	9817339	missense	probably damaging	0.99
R6284:Stxbp5	UTSW	10	9767179	missense	probably benign	0.32
R6284:Stxbp5	UTSW	10	9767187	missense	probably damaging	1.00
R6394:Stxbp5	UTSW	10	9899231	nonsense	probably null
R6427:Stxbp5	UTSW	10	9899254	missense	probably damaging	1.00
R6894:Stxbp5	UTSW	10	9784361	missense	probably benign	0.00
R7229:Stxbp5	UTSW	10	9798187	missense	probably damaging	1.00
R7337:Stxbp5	UTSW	10	9809130	missense	possibly damaging	0.93
R7686:Stxbp5	UTSW	10	9769410	missense	probably damaging	0.99
R7811:Stxbp5	UTSW	10	9808504	missense	probably benign
R7974:Stxbp5	UTSW	10	9770695	splice site	probably null
R8009:Stxbp5	UTSW	10	9816302	missense	probably damaging	1.00
R8287:Stxbp5	UTSW	10	9784385	missense	probably benign
R8353:Stxbp5	UTSW	10	9809048	missense	probably benign	0.30
R8360:Stxbp5	UTSW	10	9812259	critical splice donor site	probably null
R8453:Stxbp5	UTSW	10	9809048	missense	probably benign	0.30
R8487:Stxbp5	UTSW	10	9812289	missense	possibly damaging	0.80
R8548:Stxbp5	UTSW	10	9817306	missense	probably null	0.98
R8805:Stxbp5	UTSW	10	9838115	nonsense	probably null
R9172:Stxbp5	UTSW	10	9769408	missense	possibly damaging	0.94
R9472:Stxbp5	UTSW	10	9843357	missense	probably damaging	1.00
R9513:Stxbp5	UTSW	10	9812010	missense	probably benign	0.17
R9649:Stxbp5	UTSW	10	9899194	missense	probably damaging	0.96
X0020:Stxbp5	UTSW	10	9762890	missense	possibly damaging	0.47
Z1176:Stxbp5	UTSW	10	9900545	missense	possibly damaging	0.88

Predicted Primers

PCR Primer
(F):5'- TTTGCACAAAACAGGTGGTG -3'
(R):5'- GGTAGACAGAAATTATTGGTTGGCAC -3'

Sequencing Primer
(F):5'- CTCAGACAATTGCCATGG -3'
(R):5'- GCGGGAAGAATTAGCAAGTTTTG -3'

Posted On

2016-03-17