Mutagenetix > Incidental Mutation

Incidental Mutation 'R0401:Rims2'

38248

Institutional Source

Beutler Lab

Gene Symbol

Rims2

Ensembl Gene

ENSMUSG00000037386

Gene Name

regulating synaptic membrane exocytosis 2

Synonyms

2810036I15Rik, Syt3-rs, RIM2

MMRRC Submission

038606-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.626) question?

Stock #

R0401 (G1)

Quality Score

134

Status

Validated

Chromosome

Chromosomal Location

39198261-39684372 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to C at 39509632 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042917] [ENSMUST00000082054] [ENSMUST00000227243]

AlphaFold

Q9EQZ7

Predicted Effect

probably benign
Transcript: ENSMUST00000042917

SMART Domains

Protein: ENSMUSP00000048719
Gene: ENSMUSG00000037386

Domain	Start	End	E-Value	Type
low complexity region	3	24	N/A	INTRINSIC
Pfam:FYVE_2	30	154	9.5e-18	PFAM
low complexity region	315	335	N/A	INTRINSIC
low complexity region	492	498	N/A	INTRINSIC
low complexity region	511	521	N/A	INTRINSIC
low complexity region	527	540	N/A	INTRINSIC
PDZ	646	725	8.27e-16	SMART
low complexity region	740	748	N/A	INTRINSIC
C2	790	897	4.08e-21	SMART
low complexity region	905	919	N/A	INTRINSIC
low complexity region	1085	1101	N/A	INTRINSIC
low complexity region	1116	1130	N/A	INTRINSIC
low complexity region	1208	1238	N/A	INTRINSIC
C2	1432	1535	3.78e-16	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000082054

SMART Domains

Protein: ENSMUSP00000080711
Gene: ENSMUSG00000037386

Domain	Start	End	E-Value	Type
low complexity region	3	24	N/A	INTRINSIC
Pfam:FYVE_2	76	194	2.2e-11	PFAM
low complexity region	355	375	N/A	INTRINSIC
low complexity region	532	538	N/A	INTRINSIC
low complexity region	551	561	N/A	INTRINSIC
low complexity region	567	580	N/A	INTRINSIC
PDZ	686	765	8.27e-16	SMART
low complexity region	780	788	N/A	INTRINSIC
C2	830	937	4.08e-21	SMART
low complexity region	945	959	N/A	INTRINSIC
low complexity region	1075	1086	N/A	INTRINSIC
low complexity region	1166	1196	N/A	INTRINSIC
C2	1390	1493	3.78e-16	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000227243

Predicted Effect

probably benign
Transcript: ENSMUST00000227381

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.6%

Validation Efficiency

98% (90/92)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a presynaptic protein that interacts with RAB3, a protein important for normal neurotransmitter release. The encoded protein can also bind several other synaptic proteins, including UNC-13 homolog B, ELKS/Rab6-interacting/CAST family member 1, and synaptotagmin 1. This protein is involved in synaptic membrane exocytosis. Polymorphisms in this gene have been associated with degenerative lumbar scoliosis. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for a knock-out allele show reduced body size, aberrant insulin granule exocytosis, and impaired secretion of hormones associated with glucose homeostasis. Mice homozygous for another knock-out allele show a slightly reduced body size, abnormal maternal behavior and premature death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 91 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	A	T	3: 138,070,306	H1752L	possibly damaging	Het
8030462N17Rik	C	A	18: 77,673,962	S218I	probably damaging	Het
A530099J19Rik	A	T	13: 19,729,494		noncoding transcript	Het
Abcc5	T	C	16: 20,376,558	K730E	probably benign	Het
Ahnak	A	G	19: 9,015,116	D4588G	probably benign	Het
AI467606	G	A	7: 127,092,436	R61H	probably damaging	Het
Apoa4	T	A	9: 46,243,058	V319E	probably damaging	Het
Atad5	T	A	11: 80,120,699	D1297E	probably benign	Het
BC005624	G	A	2: 30,980,009	T62I	probably benign	Het
Bcl6	T	C	16: 23,972,594	K337E	probably damaging	Het
Cad	T	A	5: 31,073,986		probably benign	Het
Ccdc73	T	C	2: 104,991,289	S528P	probably benign	Het
Ccng2	T	G	5: 93,273,413	C261G	possibly damaging	Het
Cdh11	A	T	8: 102,674,006	I110N	probably damaging	Het
Cgnl1	A	G	9: 71,705,239	V767A	probably damaging	Het
Cit	A	G	5: 115,985,479	T1460A	probably benign	Het
Clec4b2	C	T	6: 123,181,300	Q42*	probably null	Het
Clip1	A	G	5: 123,653,789	V106A	probably damaging	Het
Crb1	T	C	1: 139,198,791		probably benign	Het
Cts6	T	C	13: 61,198,339		probably benign	Het
Cul9	T	C	17: 46,541,704	E244G	probably damaging	Het
Ddx55	A	T	5: 124,567,951	I480F	probably damaging	Het
Dixdc1	A	G	9: 50,693,674	S17P	possibly damaging	Het
Drosha	T	A	15: 12,926,031	Y1235*	probably null	Het
Dsg2	G	T	18: 20,592,508		probably benign	Het
E2f5	T	C	3: 14,579,025		probably null	Het
Epc2	A	G	2: 49,528,974	T265A	probably damaging	Het
Etaa1	T	G	11: 17,947,514	D201A	probably damaging	Het
Fancd2	T	C	6: 113,548,343	I260T	possibly damaging	Het
Fhdc1	G	A	3: 84,444,624	A1098V	probably benign	Het
Gm17689	G	T	9: 36,582,628	A3E	unknown	Het
Gm7030	C	T	17: 36,128,705	V128M	probably damaging	Het
Gpd2	G	A	2: 57,340,093	V286I	possibly damaging	Het
Herc2	A	C	7: 56,157,732	E2523A	probably damaging	Het
Jmjd1c	G	A	10: 67,220,382	R527H	probably damaging	Het
Kif12	G	A	4: 63,169,525		probably benign	Het
Lrp2	A	T	2: 69,479,148	N2802K	probably damaging	Het
Mab21l2	C	G	3: 86,546,989	G235R	probably benign	Het
Mapk8	T	C	14: 33,382,208	E417G	probably benign	Het
Mapk8ip3	G	A	17: 24,909,171		probably benign	Het
Mettl1	A	G	10: 127,045,077	T203A	probably benign	Het
Mettl9	T	C	7: 121,076,313	V312A	probably damaging	Het
Mex3d	A	G	10: 80,386,894	V176A	probably benign	Het
Mmp3	T	C	9: 7,449,790	S225P	probably damaging	Het
Mrvi1	G	A	7: 110,876,897	P757S	probably benign	Het
Neb	G	A	2: 52,188,677		probably benign	Het
Ninj2	C	T	6: 120,198,051	A51V	possibly damaging	Het
Nle1	A	G	11: 82,905,379		probably benign	Het
Nol9	T	C	4: 152,052,605	Y532H	probably benign	Het
Nr2c1	T	A	10: 94,171,158	V286E	probably benign	Het
Olfr1183	T	G	2: 88,461,925	L195R	probably damaging	Het
Olfr1272	A	T	2: 90,282,404	M57K	probably damaging	Het
Olfr308	T	C	7: 86,321,292	Y220C	probably benign	Het
Olfr481	T	A	7: 108,080,872	I26N	possibly damaging	Het
Olfr670	T	A	7: 104,959,943	H263L	probably damaging	Het
Olfr816	A	G	10: 129,911,916	Y121H	probably benign	Het
Olfr827	A	G	10: 130,210,620	L170P	probably damaging	Het
Ovch2	A	T	7: 107,801,136	V15D	probably damaging	Het
Pclo	T	G	5: 14,681,734	S3417A	unknown	Het
Pet2	C	A	X: 89,405,209	R438L	probably benign	Het
Pex1	T	A	5: 3,633,759	M1085K	probably damaging	Het
Plscr2	T	C	9: 92,282,135	S6P	probably benign	Het
Pogz	C	T	3: 94,877,025	P722S	possibly damaging	Het
Pom121l2	A	T	13: 21,982,225	D222V	probably benign	Het
Prpf40a	T	C	2: 53,159,313	Y179C	probably damaging	Het
R3hdm2	A	G	10: 127,458,173	I179V	possibly damaging	Het
Ranbp9	A	C	13: 43,422,658	V355G	probably damaging	Het
Ryr2	A	T	13: 11,705,684	S2693T	probably benign	Het
Sbno1	G	A	5: 124,410,285	T111I	probably damaging	Het
Sdk1	A	C	5: 142,046,161	N997T	possibly damaging	Het
Setx	G	T	2: 29,166,289	E39*	probably null	Het
Skint7	T	A	4: 111,980,362	N112K	probably damaging	Het
Slc35e1	T	C	8: 72,492,571		probably benign	Het
Slc4a10	A	T	2: 62,190,848	D80V	probably benign	Het
Susd2	C	A	10: 75,638,603		probably benign	Het
Tcam1	G	A	11: 106,284,078	E120K	probably benign	Het
Tcf3	G	T	10: 80,421,158	S77R	probably damaging	Het
Tdpoz3	T	C	3: 93,826,365	Y116H	probably benign	Het
Tex26	C	A	5: 149,460,858	D164E	probably benign	Het
Thoc5	G	A	11: 4,902,213		probably benign	Het
Tiparp	A	G	3: 65,531,436	R58G	probably benign	Het
Trim66	A	T	7: 109,475,264	C597S	probably damaging	Het
Ugt2a3	T	A	5: 87,336,490	Q225L	probably benign	Het
Vmn1r25	T	A	6: 57,978,711	I198L	probably benign	Het
Vmn2r106	A	T	17: 20,279,019	V210D	possibly damaging	Het
Vmn2r124	T	C	17: 18,064,145	F483L	probably damaging	Het
Vmn2r78	A	G	7: 86,921,311	K346E	probably benign	Het
Zfhx4	T	A	3: 5,401,161	S2126R	possibly damaging	Het
Zfp608	C	T	18: 54,898,994	G625R	probably benign	Het
Zkscan5	A	G	5: 145,212,575	D234G	probably damaging	Het
Zscan10	T	A	17: 23,605,915	V115E	probably damaging	Het

Other mutations in Rims2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00339:Rims2	APN	15	39459615	missense	probably benign	0.11
IGL00502:Rims2	APN	15	39506984	missense	probably damaging	1.00
IGL00556:Rims2	APN	15	39456674	splice site	probably null
IGL00811:Rims2	APN	15	39292149	missense	probably damaging	1.00
IGL00827:Rims2	APN	15	39472359	missense	probably damaging	0.99
IGL01642:Rims2	APN	15	39457796	missense	probably damaging	1.00
IGL02951:Rims2	APN	15	39534938	missense	probably damaging	1.00
IGL03009:Rims2	APN	15	39566997	missense	possibly damaging	0.85
IGL03080:Rims2	APN	15	39535903	missense	probably damaging	1.00
IGL03102:Rims2	APN	15	39459593	missense	possibly damaging	0.95
IGL03252:Rims2	APN	15	39452352	missense	probably benign
IGL03365:Rims2	APN	15	39476541	missense	probably damaging	1.00
IGL03393:Rims2	APN	15	39462613	splice site	probably null
IGL03409:Rims2	APN	15	39456733	missense	probably damaging	1.00
rhyme	UTSW	15	39452328	missense	probably damaging	1.00
PIT4486001:Rims2	UTSW	15	39476520	missense	possibly damaging	0.67
R0009:Rims2	UTSW	15	39534966	missense	probably damaging	0.99
R0009:Rims2	UTSW	15	39534966	missense	probably damaging	0.99
R0078:Rims2	UTSW	15	39534855	missense	probably benign	0.42
R0367:Rims2	UTSW	15	39462615	splice site	probably null
R0531:Rims2	UTSW	15	39567030	missense	probably damaging	1.00
R0791:Rims2	UTSW	15	39679625	splice site	probably benign
R0838:Rims2	UTSW	15	39681025	missense	probably benign	0.02
R1201:Rims2	UTSW	15	39616324	missense	possibly damaging	0.91
R1318:Rims2	UTSW	15	39517826	missense	probably damaging	0.99
R1457:Rims2	UTSW	15	39511314	missense	possibly damaging	0.63
R1619:Rims2	UTSW	15	39506986	missense	probably damaging	1.00
R1672:Rims2	UTSW	15	39292189	missense	probably benign	0.09
R1743:Rims2	UTSW	15	39679650	missense	probably benign	0.10
R1766:Rims2	UTSW	15	39462580	missense	probably damaging	0.99
R1779:Rims2	UTSW	15	39681702	missense	probably damaging	1.00
R1804:Rims2	UTSW	15	39437043	nonsense	probably null
R1985:Rims2	UTSW	15	39345314	missense	probably damaging	0.99
R1986:Rims2	UTSW	15	39345314	missense	probably damaging	0.99
R2113:Rims2	UTSW	15	39511326	missense	probably benign	0.17
R2260:Rims2	UTSW	15	39478566	nonsense	probably null
R2510:Rims2	UTSW	15	39585652	missense	probably damaging	1.00
R3693:Rims2	UTSW	15	39478575	missense	probably benign	0.01
R3937:Rims2	UTSW	15	39437845	missense	probably damaging	1.00
R4425:Rims2	UTSW	15	39437924	critical splice donor site	probably null
R4453:Rims2	UTSW	15	39292208	missense	probably damaging	1.00
R4474:Rims2	UTSW	15	39462560	missense	probably damaging	1.00
R4518:Rims2	UTSW	15	39437526	missense	probably damaging	1.00
R4526:Rims2	UTSW	15	39437717	missense	probably damaging	1.00
R4833:Rims2	UTSW	15	39535914	missense	probably damaging	0.98
R4936:Rims2	UTSW	15	39437728	missense	probably damaging	1.00
R4993:Rims2	UTSW	15	39454445	missense	possibly damaging	0.90
R5001:Rims2	UTSW	15	39452428	missense	probably benign	0.03
R5054:Rims2	UTSW	15	39517869	splice site	probably null
R5072:Rims2	UTSW	15	39462590	missense	probably benign	0.01
R5171:Rims2	UTSW	15	39437103	missense	probably damaging	1.00
R5429:Rims2	UTSW	15	39345355	missense	probably damaging	1.00
R5623:Rims2	UTSW	15	39478615	missense	probably damaging	1.00
R5624:Rims2	UTSW	15	39345413	missense	possibly damaging	0.46
R5685:Rims2	UTSW	15	39437206	missense	possibly damaging	0.67
R5784:Rims2	UTSW	15	39535987	splice site	probably null
R5790:Rims2	UTSW	15	39681045	missense	probably damaging	1.00
R5822:Rims2	UTSW	15	39476490	missense	probably damaging	1.00
R5963:Rims2	UTSW	15	39437182	missense	probably damaging	1.00
R5988:Rims2	UTSW	15	39292182	missense	probably damaging	1.00
R6057:Rims2	UTSW	15	39675020	missense	probably damaging	1.00
R6239:Rims2	UTSW	15	39198363	start codon destroyed	unknown
R6407:Rims2	UTSW	15	39452328	missense	probably damaging	1.00
R6418:Rims2	UTSW	15	39509696	missense	probably damaging	1.00
R6495:Rims2	UTSW	15	39517812	missense	probably benign	0.01
R6502:Rims2	UTSW	15	39534855	missense	probably benign	0.42
R6753:Rims2	UTSW	15	39566973	missense	possibly damaging	0.74
R6855:Rims2	UTSW	15	39345515	missense	probably benign	0.06
R6948:Rims2	UTSW	15	39511341	missense	probably benign
R7058:Rims2	UTSW	15	39585648	missense	probably damaging	1.00
R7167:Rims2	UTSW	15	39437077	missense	probably benign
R7217:Rims2	UTSW	15	39476489	missense	probably damaging	0.99
R7223:Rims2	UTSW	15	39437032	missense	probably benign	0.30
R7289:Rims2	UTSW	15	39437718	missense	probably benign	0.00
R7459:Rims2	UTSW	15	39517839	missense	probably benign
R7663:Rims2	UTSW	15	39507026	missense	probably damaging	1.00
R7792:Rims2	UTSW	15	39198528	missense	possibly damaging	0.69
R7836:Rims2	UTSW	15	39681079	missense	probably damaging	1.00
R8082:Rims2	UTSW	15	39476523	missense	probably benign	0.34
R8489:Rims2	UTSW	15	39616450	missense	probably damaging	1.00
R8730:Rims2	UTSW	15	39517843	missense	probably benign	0.01
R8830:Rims2	UTSW	15	39437362	missense	possibly damaging	0.64
R8857:Rims2	UTSW	15	39679648	missense	possibly damaging	0.95
R8893:Rims2	UTSW	15	39534954	missense	probably benign	0.02
R9010:Rims2	UTSW	15	39452390	nonsense	probably null
R9030:Rims2	UTSW	15	39476477	missense	probably damaging	1.00
R9287:Rims2	UTSW	15	39679690	missense	probably damaging	1.00
R9395:Rims2	UTSW	15	39292269	missense	probably damaging	1.00
R9451:Rims2	UTSW	15	39437328	missense	probably damaging	1.00
R9506:Rims2	UTSW	15	39472436	missense	probably damaging	0.97
X0034:Rims2	UTSW	15	39437534	missense	probably benign
Z1177:Rims2	UTSW	15	39437769	missense	probably benign	0.24
Z1177:Rims2	UTSW	15	39478690	frame shift	probably null
Z1177:Rims2	UTSW	15	39681114	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCATTGCAGGAAAATGGCATCAAGC -3'
(R):5'- TAGGCGACCATGACCTTGTCCTTC -3'

Sequencing Primer
(F):5'- TTACAAACCTAGCAAGTCCTGTG -3'
(R):5'- CCTATAACATCTACTCGATGAGGAG -3'

Posted On

2013-05-23