Mutagenetix > Incidental Mutation

Incidental Mutation 'R5054:Rims2'

390734

Institutional Source

Beutler Lab

Gene Symbol

Rims2

Ensembl Gene

ENSMUSG00000037386

Gene Name

regulating synaptic membrane exocytosis 2

Synonyms

2810036I15Rik, Syt3-rs, RIM2

MMRRC Submission

042644-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.626) question?

Stock #

R5054 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

39198261-39684372 bp(+) (GRCm38)

Type of Mutation

splice site (6495 bp from exon)

DNA Base Change (assembly)

A to T at 39517869 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042917] [ENSMUST00000082054] [ENSMUST00000227243]

AlphaFold

Q9EQZ7

Predicted Effect

probably null
Transcript: ENSMUST00000042917

SMART Domains

Protein: ENSMUSP00000048719
Gene: ENSMUSG00000037386

Domain	Start	End	E-Value	Type
low complexity region	3	24	N/A	INTRINSIC
Pfam:FYVE_2	30	154	9.5e-18	PFAM
low complexity region	315	335	N/A	INTRINSIC
low complexity region	492	498	N/A	INTRINSIC
low complexity region	511	521	N/A	INTRINSIC
low complexity region	527	540	N/A	INTRINSIC
PDZ	646	725	8.27e-16	SMART
low complexity region	740	748	N/A	INTRINSIC
C2	790	897	4.08e-21	SMART
low complexity region	905	919	N/A	INTRINSIC
low complexity region	1085	1101	N/A	INTRINSIC
low complexity region	1116	1130	N/A	INTRINSIC
low complexity region	1208	1238	N/A	INTRINSIC
C2	1432	1535	3.78e-16	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000082054

SMART Domains

Protein: ENSMUSP00000080711
Gene: ENSMUSG00000037386

Domain	Start	End	E-Value	Type
low complexity region	3	24	N/A	INTRINSIC
Pfam:FYVE_2	76	194	2.2e-11	PFAM
low complexity region	355	375	N/A	INTRINSIC
low complexity region	532	538	N/A	INTRINSIC
low complexity region	551	561	N/A	INTRINSIC
low complexity region	567	580	N/A	INTRINSIC
PDZ	686	765	8.27e-16	SMART
low complexity region	780	788	N/A	INTRINSIC
C2	830	937	4.08e-21	SMART
low complexity region	945	959	N/A	INTRINSIC
low complexity region	1075	1086	N/A	INTRINSIC
low complexity region	1166	1196	N/A	INTRINSIC
C2	1390	1493	3.78e-16	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000227243

Predicted Effect

probably null
Transcript: ENSMUST00000227381

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.1%

Validation Efficiency

94% (67/71)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a presynaptic protein that interacts with RAB3, a protein important for normal neurotransmitter release. The encoded protein can also bind several other synaptic proteins, including UNC-13 homolog B, ELKS/Rab6-interacting/CAST family member 1, and synaptotagmin 1. This protein is involved in synaptic membrane exocytosis. Polymorphisms in this gene have been associated with degenerative lumbar scoliosis. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for a knock-out allele show reduced body size, aberrant insulin granule exocytosis, and impaired secretion of hormones associated with glucose homeostasis. Mice homozygous for another knock-out allele show a slightly reduced body size, abnormal maternal behavior and premature death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921517D22Rik	A	G	13: 59,689,501	Y257H	probably damaging	Het
Adam28	C	T	14: 68,617,715	C659Y	probably damaging	Het
Adamtsl2	G	A	2: 27,101,720	E627K	probably damaging	Het
Atad5	T	A	11: 80,094,676	S196R	probably benign	Het
Bcam	T	A	7: 19,756,860		probably benign	Het
Birc6	A	G	17: 74,655,325	H3978R	probably damaging	Het
Btbd7	T	C	12: 102,838,212	I190V	probably benign	Het
Ccdc8	T	C	7: 16,995,045	V153A	probably damaging	Het
Cyp2a5	C	G	7: 26,841,104	R68G	probably damaging	Het
Dock3	T	C	9: 106,937,906	Y1254C	probably damaging	Het
Dync2h1	T	C	9: 7,085,007	E2794G	possibly damaging	Het
Dytn	C	A	1: 63,661,159	V271L	possibly damaging	Het
Eif2s2	A	C	2: 154,892,670		probably null	Het
Fndc7	A	G	3: 108,881,347	S193P	probably damaging	Het
Fzr1	G	A	10: 81,371,419		probably benign	Het
Gm17472	T	C	6: 42,981,004	I69T	probably damaging	Het
Gm5039	T	C	12: 88,321,301	I61V	probably benign	Het
Gmppa	C	A	1: 75,439,371	Y137*	probably null	Het
Gpr45	A	G	1: 43,032,649	I151V	probably benign	Het
H1f0	G	A	15: 79,028,773	A18T	probably damaging	Het
Hbb-bh1	C	T	7: 103,841,856	V114I	probably benign	Het
Impa2	C	A	18: 67,306,727	P98Q	probably damaging	Het
Kazn	T	C	4: 142,108,646	N573D	unknown	Het
Kcna2	A	T	3: 107,104,340	D79V	probably damaging	Het
Kcna7	G	A	7: 45,406,591	R77H	probably damaging	Het
Kif13a	A	G	13: 46,802,646	Y561H	probably damaging	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Klra1	T	A	6: 130,375,284	Q165L	probably damaging	Het
Mat2b	T	A	11: 40,680,042	R318S	probably damaging	Het
Mgat4d	G	A	8: 83,368,208		probably null	Het
Mtor	T	A	4: 148,556,855		probably null	Het
Nostrin	A	T	2: 69,175,713	Q247L	possibly damaging	Het
Obscn	T	C	11: 59,073,617	E3033G	probably damaging	Het
Pam	C	A	1: 97,821,917	D839Y	probably damaging	Het
Pds5a	A	G	5: 65,637,814	V693A	probably damaging	Het
Pigo	A	T	4: 43,021,337	L535Q	probably damaging	Het
Ppp1r12b	G	T	1: 134,955,733	A17E	probably benign	Het
Ptar1	G	T	19: 23,694,365	R44L	probably damaging	Het
Rad51c	T	C	11: 87,397,754	H201R	probably benign	Het
Rnf219	C	T	14: 104,508,030	G70E	probably damaging	Het
Rpl22l1	T	G	3: 28,806,836	S67A	possibly damaging	Het
Rps10	A	G	17: 27,630,480	S143P	probably damaging	Het
Rundc1	T	C	11: 101,425,141	V13A	probably benign	Het
Sephs2	C	A	7: 127,273,392	M176I	probably benign	Het
Serpina16	C	T	12: 103,674,930	V179I	probably benign	Het
Serpini2	T	A	3: 75,259,477	T158S	probably damaging	Het
Slc12a3	A	G	8: 94,346,351	R701G	probably damaging	Het
Slc1a6	A	G	10: 78,814,602	E558G	probably damaging	Het
Ssx2ip	T	C	3: 146,430,917		probably benign	Het
Tbr1	A	T	2: 61,806,002	I241F	possibly damaging	Het
Tgfa	G	C	6: 86,270,082		probably null	Het
Tlr12	T	A	4: 128,617,270	K396*	probably null	Het
Tmppe	A	G	9: 114,405,958	I442V	probably benign	Het
Tubb3	T	C	8: 123,420,868	V180A	probably damaging	Het
Vmn1r222	A	G	13: 23,232,731	V104A	probably damaging	Het
Vmn2r95	G	T	17: 18,451,446	V482L	possibly damaging	Het
Zfp184	G	T	13: 21,959,282	R386L	possibly damaging	Het
Zfp444	T	A	7: 6,189,793	V270E	probably damaging	Het
Zfp985	A	T	4: 147,582,981	Y102F	probably damaging	Het

Other mutations in Rims2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00339:Rims2	APN	15	39459615	missense	probably benign	0.11
IGL00502:Rims2	APN	15	39506984	missense	probably damaging	1.00
IGL00556:Rims2	APN	15	39456674	splice site	probably null
IGL00811:Rims2	APN	15	39292149	missense	probably damaging	1.00
IGL00827:Rims2	APN	15	39472359	missense	probably damaging	0.99
IGL01642:Rims2	APN	15	39457796	missense	probably damaging	1.00
IGL02951:Rims2	APN	15	39534938	missense	probably damaging	1.00
IGL03009:Rims2	APN	15	39566997	missense	possibly damaging	0.85
IGL03080:Rims2	APN	15	39535903	missense	probably damaging	1.00
IGL03102:Rims2	APN	15	39459593	missense	possibly damaging	0.95
IGL03252:Rims2	APN	15	39452352	missense	probably benign
IGL03365:Rims2	APN	15	39476541	missense	probably damaging	1.00
IGL03393:Rims2	APN	15	39462613	splice site	probably null
IGL03409:Rims2	APN	15	39456733	missense	probably damaging	1.00
rhyme	UTSW	15	39452328	missense	probably damaging	1.00
PIT4486001:Rims2	UTSW	15	39476520	missense	possibly damaging	0.67
R0009:Rims2	UTSW	15	39534966	missense	probably damaging	0.99
R0009:Rims2	UTSW	15	39534966	missense	probably damaging	0.99
R0078:Rims2	UTSW	15	39534855	missense	probably benign	0.42
R0367:Rims2	UTSW	15	39462615	splice site	probably null
R0401:Rims2	UTSW	15	39509632	splice site	probably benign
R0531:Rims2	UTSW	15	39567030	missense	probably damaging	1.00
R0791:Rims2	UTSW	15	39679625	splice site	probably benign
R0838:Rims2	UTSW	15	39681025	missense	probably benign	0.02
R1201:Rims2	UTSW	15	39616324	missense	possibly damaging	0.91
R1318:Rims2	UTSW	15	39517826	missense	probably damaging	0.99
R1457:Rims2	UTSW	15	39511314	missense	possibly damaging	0.63
R1619:Rims2	UTSW	15	39506986	missense	probably damaging	1.00
R1672:Rims2	UTSW	15	39292189	missense	probably benign	0.09
R1743:Rims2	UTSW	15	39679650	missense	probably benign	0.10
R1766:Rims2	UTSW	15	39462580	missense	probably damaging	0.99
R1779:Rims2	UTSW	15	39681702	missense	probably damaging	1.00
R1804:Rims2	UTSW	15	39437043	nonsense	probably null
R1985:Rims2	UTSW	15	39345314	missense	probably damaging	0.99
R1986:Rims2	UTSW	15	39345314	missense	probably damaging	0.99
R2113:Rims2	UTSW	15	39511326	missense	probably benign	0.17
R2260:Rims2	UTSW	15	39478566	nonsense	probably null
R2510:Rims2	UTSW	15	39585652	missense	probably damaging	1.00
R3693:Rims2	UTSW	15	39478575	missense	probably benign	0.01
R3937:Rims2	UTSW	15	39437845	missense	probably damaging	1.00
R4425:Rims2	UTSW	15	39437924	critical splice donor site	probably null
R4453:Rims2	UTSW	15	39292208	missense	probably damaging	1.00
R4474:Rims2	UTSW	15	39462560	missense	probably damaging	1.00
R4518:Rims2	UTSW	15	39437526	missense	probably damaging	1.00
R4526:Rims2	UTSW	15	39437717	missense	probably damaging	1.00
R4833:Rims2	UTSW	15	39535914	missense	probably damaging	0.98
R4936:Rims2	UTSW	15	39437728	missense	probably damaging	1.00
R4993:Rims2	UTSW	15	39454445	missense	possibly damaging	0.90
R5001:Rims2	UTSW	15	39452428	missense	probably benign	0.03
R5072:Rims2	UTSW	15	39462590	missense	probably benign	0.01
R5171:Rims2	UTSW	15	39437103	missense	probably damaging	1.00
R5429:Rims2	UTSW	15	39345355	missense	probably damaging	1.00
R5623:Rims2	UTSW	15	39478615	missense	probably damaging	1.00
R5624:Rims2	UTSW	15	39345413	missense	possibly damaging	0.46
R5685:Rims2	UTSW	15	39437206	missense	possibly damaging	0.67
R5784:Rims2	UTSW	15	39535987	splice site	probably null
R5790:Rims2	UTSW	15	39681045	missense	probably damaging	1.00
R5822:Rims2	UTSW	15	39476490	missense	probably damaging	1.00
R5963:Rims2	UTSW	15	39437182	missense	probably damaging	1.00
R5988:Rims2	UTSW	15	39292182	missense	probably damaging	1.00
R6057:Rims2	UTSW	15	39675020	missense	probably damaging	1.00
R6239:Rims2	UTSW	15	39198363	start codon destroyed	unknown
R6407:Rims2	UTSW	15	39452328	missense	probably damaging	1.00
R6418:Rims2	UTSW	15	39509696	missense	probably damaging	1.00
R6495:Rims2	UTSW	15	39517812	missense	probably benign	0.01
R6502:Rims2	UTSW	15	39534855	missense	probably benign	0.42
R6753:Rims2	UTSW	15	39566973	missense	possibly damaging	0.74
R6855:Rims2	UTSW	15	39345515	missense	probably benign	0.06
R6948:Rims2	UTSW	15	39511341	missense	probably benign
R7058:Rims2	UTSW	15	39585648	missense	probably damaging	1.00
R7167:Rims2	UTSW	15	39437077	missense	probably benign
R7217:Rims2	UTSW	15	39476489	missense	probably damaging	0.99
R7223:Rims2	UTSW	15	39437032	missense	probably benign	0.30
R7289:Rims2	UTSW	15	39437718	missense	probably benign	0.00
R7459:Rims2	UTSW	15	39517839	missense	probably benign
R7663:Rims2	UTSW	15	39507026	missense	probably damaging	1.00
R7792:Rims2	UTSW	15	39198528	missense	possibly damaging	0.69
R7836:Rims2	UTSW	15	39681079	missense	probably damaging	1.00
R8082:Rims2	UTSW	15	39476523	missense	probably benign	0.34
R8489:Rims2	UTSW	15	39616450	missense	probably damaging	1.00
R8730:Rims2	UTSW	15	39517843	missense	probably benign	0.01
R8830:Rims2	UTSW	15	39437362	missense	possibly damaging	0.64
R8857:Rims2	UTSW	15	39679648	missense	possibly damaging	0.95
R8893:Rims2	UTSW	15	39534954	missense	probably benign	0.02
R9010:Rims2	UTSW	15	39452390	nonsense	probably null
R9030:Rims2	UTSW	15	39476477	missense	probably damaging	1.00
R9287:Rims2	UTSW	15	39679690	missense	probably damaging	1.00
R9395:Rims2	UTSW	15	39292269	missense	probably damaging	1.00
R9451:Rims2	UTSW	15	39437328	missense	probably damaging	1.00
R9506:Rims2	UTSW	15	39472436	missense	probably damaging	0.97
X0034:Rims2	UTSW	15	39437534	missense	probably benign
Z1177:Rims2	UTSW	15	39437769	missense	probably benign	0.24
Z1177:Rims2	UTSW	15	39478690	frame shift	probably null
Z1177:Rims2	UTSW	15	39681114	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCCAAGATTTTCCAGTAGCAG -3'
(R):5'- TGATGGCATCTGTAATAGCTCTC -3'

Sequencing Primer
(F):5'- GCCAAGATTTTCCAGTAGCAGTTTTC -3'
(R):5'- GATTCTAGTCCATCAAACAGA -3'

Posted On

2016-06-06