Mutagenetix > Incidental Mutations

Incidental Mutation 'R4989:Cic'

386033

Institutional Source

Beutler Lab

Gene Symbol

Cic

Ensembl Gene

ENSMUSG00000005442

Gene Name

capicua transcriptional repressor

Synonyms

1200010B10Rik

MMRRC Submission

042583-MU

Accession Numbers

Genbank: NM_027882.3, NM_001110131.1, NM_001110132.1; Ensembl: ENSMUST00000169266

Is this an essential gene?

Probably essential (E-score: 0.953) question?

Stock #

R4989 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

25267704-25294159 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 25287110 bp

Zygosity

Heterozygous

Amino Acid Change

Glycine to Cysteine at position 1289 (G1289C)

Ref Sequence

ENSEMBL: ENSMUSP00000132351 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000005578] [ENSMUST00000163320] [ENSMUST00000164820] [ENSMUST00000165239] [ENSMUST00000169266]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000005578
AA Change: G382C

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000005578
Gene: ENSMUSG00000005442
AA Change: G382C

Domain	Start	End	E-Value	Type
PDB:4J2L\|D	21	48	6e-12	PDB
low complexity region	106	120	N/A	INTRINSIC
low complexity region	124	138	N/A	INTRINSIC
HMG	199	269	1.24e-17	SMART
low complexity region	415	431	N/A	INTRINSIC
low complexity region	473	486	N/A	INTRINSIC
low complexity region	508	521	N/A	INTRINSIC
low complexity region	525	555	N/A	INTRINSIC
low complexity region	567	583	N/A	INTRINSIC
low complexity region	645	660	N/A	INTRINSIC
low complexity region	729	740	N/A	INTRINSIC
low complexity region	782	803	N/A	INTRINSIC
low complexity region	837	859	N/A	INTRINSIC
low complexity region	939	951	N/A	INTRINSIC
low complexity region	1065	1080	N/A	INTRINSIC
low complexity region	1118	1132	N/A	INTRINSIC
low complexity region	1135	1155	N/A	INTRINSIC
low complexity region	1223	1253	N/A	INTRINSIC
low complexity region	1280	1313	N/A	INTRINSIC
low complexity region	1405	1418	N/A	INTRINSIC
low complexity region	1483	1494	N/A	INTRINSIC
low complexity region	1524	1547	N/A	INTRINSIC
low complexity region	1568	1603	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000163320
AA Change: G382C

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000126659
Gene: ENSMUSG00000005442
AA Change: G382C

Domain	Start	End	E-Value	Type
PDB:4J2L\|D	21	48	6e-12	PDB
low complexity region	106	120	N/A	INTRINSIC
low complexity region	124	138	N/A	INTRINSIC
HMG	199	269	1.24e-17	SMART
low complexity region	415	431	N/A	INTRINSIC
low complexity region	473	486	N/A	INTRINSIC
low complexity region	508	521	N/A	INTRINSIC
low complexity region	525	555	N/A	INTRINSIC
low complexity region	567	583	N/A	INTRINSIC
low complexity region	645	660	N/A	INTRINSIC
low complexity region	729	740	N/A	INTRINSIC
low complexity region	782	803	N/A	INTRINSIC
low complexity region	837	859	N/A	INTRINSIC
low complexity region	939	951	N/A	INTRINSIC
low complexity region	1064	1079	N/A	INTRINSIC
low complexity region	1117	1131	N/A	INTRINSIC
low complexity region	1134	1154	N/A	INTRINSIC
low complexity region	1222	1252	N/A	INTRINSIC
low complexity region	1279	1312	N/A	INTRINSIC
low complexity region	1405	1418	N/A	INTRINSIC
low complexity region	1483	1494	N/A	INTRINSIC
low complexity region	1524	1547	N/A	INTRINSIC
low complexity region	1568	1603	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000163819

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000164440

Predicted Effect

probably benign
Transcript: ENSMUST00000164820

SMART Domains

Protein: ENSMUSP00000130146
Gene: ENSMUSG00000005442

Domain	Start	End	E-Value	Type
low complexity region	22	36	N/A	INTRINSIC
low complexity region	39	57	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000165239
AA Change: G382C

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000128071
Gene: ENSMUSG00000005442
AA Change: G382C

Domain	Start	End	E-Value	Type
PDB:4J2L\|D	21	48	5e-12	PDB
low complexity region	106	120	N/A	INTRINSIC
low complexity region	124	138	N/A	INTRINSIC
HMG	199	269	1.24e-17	SMART
low complexity region	415	431	N/A	INTRINSIC
low complexity region	473	486	N/A	INTRINSIC
low complexity region	508	521	N/A	INTRINSIC
low complexity region	525	555	N/A	INTRINSIC
low complexity region	567	583	N/A	INTRINSIC
low complexity region	645	660	N/A	INTRINSIC
low complexity region	729	740	N/A	INTRINSIC
low complexity region	782	803	N/A	INTRINSIC
low complexity region	837	859	N/A	INTRINSIC
low complexity region	939	951	N/A	INTRINSIC
low complexity region	1065	1080	N/A	INTRINSIC
low complexity region	1118	1132	N/A	INTRINSIC
low complexity region	1135	1153	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000165742

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000167162

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000167379

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000168956

Predicted Effect

probably damaging
Transcript: ENSMUST00000169266
AA Change: G1289C

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000132351
Gene: ENSMUSG00000005442
AA Change: G1289C

Domain	Start	End	E-Value	Type
low complexity region	9	23	N/A	INTRINSIC
low complexity region	33	73	N/A	INTRINSIC
low complexity region	151	165	N/A	INTRINSIC
Pfam:DUF4819	249	346	1.8e-23	PFAM
low complexity region	351	367	N/A	INTRINSIC
low complexity region	403	427	N/A	INTRINSIC
low complexity region	445	457	N/A	INTRINSIC
low complexity region	462	475	N/A	INTRINSIC
low complexity region	618	633	N/A	INTRINSIC
low complexity region	673	685	N/A	INTRINSIC
low complexity region	724	734	N/A	INTRINSIC
low complexity region	740	751	N/A	INTRINSIC
low complexity region	779	786	N/A	INTRINSIC
low complexity region	858	883	N/A	INTRINSIC
low complexity region	898	911	N/A	INTRINSIC
PDB:4J2L\|D	930	955	5e-10	PDB
low complexity region	1013	1027	N/A	INTRINSIC
low complexity region	1031	1045	N/A	INTRINSIC
HMG	1106	1176	1.24e-17	SMART
low complexity region	1322	1338	N/A	INTRINSIC
low complexity region	1380	1393	N/A	INTRINSIC
low complexity region	1415	1428	N/A	INTRINSIC
low complexity region	1432	1462	N/A	INTRINSIC
low complexity region	1474	1490	N/A	INTRINSIC
low complexity region	1552	1567	N/A	INTRINSIC
low complexity region	1636	1647	N/A	INTRINSIC
low complexity region	1689	1710	N/A	INTRINSIC
low complexity region	1744	1766	N/A	INTRINSIC
low complexity region	1846	1858	N/A	INTRINSIC
low complexity region	1971	1986	N/A	INTRINSIC
low complexity region	2024	2038	N/A	INTRINSIC
low complexity region	2041	2061	N/A	INTRINSIC
low complexity region	2129	2159	N/A	INTRINSIC
low complexity region	2186	2219	N/A	INTRINSIC
low complexity region	2311	2324	N/A	INTRINSIC
low complexity region	2389	2400	N/A	INTRINSIC
low complexity region	2430	2453	N/A	INTRINSIC
low complexity region	2474	2509	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000169743

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000170500

Meta Mutation Damage Score

0.0897

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.4%

Validation Efficiency

100% (115/115)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an ortholog of the Drosophila melanogaster capicua gene, and is a member of the high mobility group (HMG)-box superfamily of transcriptional repressors. This protein contains a conserved HMG domain that is involved in DNA binding and nuclear localization, and a conserved C-terminus. Studies suggest that the N-terminal region of this protein interacts with Atxn1 (GeneID:6310), to form a transcription repressor complex, and in vitro studies suggest that polyglutamine-expansion of ATXN1 may alter the repressor activity of this complex. Mutations in this gene have been associated with olidogdendrogliomas (PMID:21817013). In addition, translocation events resulting in gene fusions of this gene with both DUX4 (GeneID:100288687) and FOXO4 (GeneID:4303) have been associated with round cell sarcomas. There are multiple pseudogenes of this gene found on chromosomes 1, 4, 6, 7, 16, 20, and the Y chromosome. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Feb 2015]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit partial postnatal lethality, decreased body size, and severe lung alveolarization defects. [provided by MGI curators]

Allele List at MGI

All alleles(61) : Targeted, other(4) Gene trapped(57)

Other mutations in this stock

Total: 114 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700049A03Rik	G	T	12: 71,164,546	E685*	probably null	Het
2700049A03Rik	A	T	12: 71,164,547	E685V	possibly damaging	Het
4931406P16Rik	A	C	7: 34,245,800	Y552D	probably damaging	Het
Acot6	A	G	12: 84,109,015	K246E	probably benign	Het
Actl11	T	A	9: 107,931,416	H979Q	probably damaging	Het
Adal	T	A	2: 121,155,549		probably benign	Het
Add2	G	A	6: 86,110,858	V596I	probably benign	Het
Adrb3	A	C	8: 27,227,770	M217R	probably damaging	Het
Akap2	T	A	4: 57,856,552	V668E	probably benign	Het
Ank1	T	C	8: 23,141,118		probably benign	Het
Ank2	A	T	3: 126,963,445	N1054K	possibly damaging	Het
Ankib1	T	C	5: 3,713,217	Y504C	probably damaging	Het
Ankrd29	T	C	18: 12,262,185	K217R	probably damaging	Het
Ankrd45	T	C	1: 161,155,306	V129A	probably damaging	Het
Aox4	A	T	1: 58,236,676	D389V	probably benign	Het
Aph1a	G	T	3: 95,895,531	G148W	probably damaging	Het
Arhgef26	G	A	3: 62,340,385	D297N	possibly damaging	Het
Atxn7l3b	C	A	10: 112,928,744		probably benign	Het
Auh	A	G	13: 52,841,029	S167P	probably damaging	Het
Bach1	A	T	16: 87,719,000	K143I	possibly damaging	Het
Bbx	T	A	16: 50,224,738	T487S	probably damaging	Het
Bche	T	G	3: 73,701,844	D83A	probably benign	Het
Bri3bp	G	T	5: 125,441,696		probably benign	Het
Cd3d	A	T	9: 44,984,998	E28D	probably damaging	Het
Cdc42bpa	A	G	1: 180,137,801	T1028A	probably damaging	Het
Celsr2	T	C	3: 108,412,629	I956V	possibly damaging	Het
Cep95	A	T	11: 106,816,654		probably null	Het
Cndp1	A	G	18: 84,631,900	Y223H	probably damaging	Het
Cops8	A	G	1: 90,611,002	D51G	probably damaging	Het
Csgalnact1	T	C	8: 68,460,971	E194G	probably benign	Het
Ctsm	A	G	13: 61,538,962	Y39H	probably damaging	Het
Dhrs2	T	C	14: 55,237,265	V119A	probably damaging	Het
Drosha	T	A	15: 12,935,007	M1336K	probably benign	Het
Dsp	G	A	13: 38,197,702	D2808N	possibly damaging	Het
Ehmt1	G	T	2: 24,877,497	P135T	probably damaging	Het
Epas1	A	G	17: 86,809,454	N184S	probably damaging	Het
Erich3	C	T	3: 154,748,388	T597I	possibly damaging	Het
F10	T	C	8: 13,055,698	V421A	probably damaging	Het
Fabp3	C	T	4: 130,312,387	T57I	probably benign	Het
Fam227b	G	A	2: 126,116,123	P241S	probably damaging	Het
Fcgrt	C	T	7: 45,101,948	G192D	probably benign	Het
Fras1	A	G	5: 96,650,682	E1184G	possibly damaging	Het
Gm5155	A	G	7: 17,905,218		probably null	Het
Gm8989	A	T	7: 106,329,457		noncoding transcript	Het
Grn	C	A	11: 102,430,554		probably benign	Het
Hadh	A	T	3: 131,235,548	L274*	probably null	Het
Hus1	T	C	11: 9,006,027	S169G	probably damaging	Het
Hydin	A	T	8: 110,563,922	I3338F	possibly damaging	Het
Ighv11-1	T	G	12: 113,982,148	E28D	probably benign	Het
Kctd9	C	T	14: 67,729,356	T106I	probably damaging	Het
Krit1	A	T	5: 3,822,238	N421I	probably damaging	Het
Lamb1	A	G	12: 31,326,678	D1619G	probably damaging	Het
Lpar6	G	A	14: 73,238,707	C36Y	probably damaging	Het
Lrrc37a	G	C	11: 103,456,739	F3043L	unknown	Het
Lrrc46	A	T	11: 97,040,939	V19D	probably damaging	Het
Mapkap1	G	T	2: 34,581,291	S197I	probably damaging	Het
Mrps35	A	C	6: 147,060,147	K173N	possibly damaging	Het
Mtf2	A	G	5: 108,073,028		probably benign	Het
Mum1	T	C	10: 80,232,868	L282P	probably benign	Het
Ncf1	A	C	5: 134,223,413	D261E	probably damaging	Het
Notch1	C	T	2: 26,481,181	E298K	probably damaging	Het
Nrxn1	A	T	17: 90,620,846		probably benign	Het
Olfr110	G	T	17: 37,499,126	L158F	probably benign	Het
Olfr1274-ps	T	A	2: 90,400,763	M34K	probably benign	Het
Olfr195	T	C	16: 59,149,618	L256P	probably damaging	Het
Olfr46	C	A	7: 140,610,391	A75E	possibly damaging	Het
Olfr622	A	G	7: 103,640,101	F13S	probably damaging	Het
Otud4	G	A	8: 79,655,689	V176I	probably damaging	Het
Papolg	T	C	11: 23,873,919		probably null	Het
Pgk2	A	G	17: 40,207,511	V342A	probably damaging	Het
Phf2	G	A	13: 48,807,844	A790V	unknown	Het
Prkdc	T	C	16: 15,673,997	I602T	possibly damaging	Het
Prl3d3	T	C	13: 27,159,089	I86T	possibly damaging	Het
Prss8	G	T	7: 127,926,463	Q295K	probably benign	Het
Ptpre	C	T	7: 135,669,132	H346Y	probably benign	Het
Ptpro	T	A	6: 137,443,594	V1007D	probably damaging	Het
Qrfpr	A	G	3: 36,222,136	V35A	probably damaging	Het
Rpf1	A	G	3: 146,506,538	L349S	probably damaging	Het
Rpl41	G	T	10: 128,548,783		probably null	Het
Rprd2	G	C	3: 95,765,320	R924G	probably benign	Het
Serpini1	T	A	3: 75,614,488	N95K	probably benign	Het
Sfxn1	A	T	13: 54,088,914	T64S	probably benign	Het
Siae	T	G	9: 37,646,520	I541S	possibly damaging	Het
Slc25a4	T	A	8: 46,207,472	K296N	probably benign	Het
Slc37a1	A	G	17: 31,322,146	N204S	probably damaging	Het
Slc9c1	A	G	16: 45,593,437	N976S	probably benign	Het
Smarcal1	T	C	1: 72,632,860	S847P	possibly damaging	Het
Smg1	A	T	7: 118,158,100		probably benign	Het
Smg1	C	T	7: 118,208,051	A168T	probably benign	Het
Sptlc1	A	G	13: 53,351,656	I242T	probably damaging	Het
St8sia2	T	C	7: 73,966,961	I89V	possibly damaging	Het
Supt20	A	T	3: 54,695,134		probably benign	Het
Tep1	T	C	14: 50,839,000	D1659G	probably benign	Het
Tex10	C	A	4: 48,458,525		probably benign	Het
Thbs3	CAGAAG	CAG	3: 89,223,102		probably benign	Het
Tmbim6	C	A	15: 99,402,069	S22*	probably null	Het
Tmc2	A	T	2: 130,202,041	K65M	possibly damaging	Het
Tmod1	A	G	4: 46,090,872	S142G	probably damaging	Het
Tns2	C	T	15: 102,108,934	R281C	probably damaging	Het
Trmt6	T	C	2: 132,808,271	R349G	possibly damaging	Het
Ttn	T	A	2: 76,707,242	T26454S	possibly damaging	Het
Ttn	C	T	2: 76,774,778	V16555I	probably benign	Het
Ubr3	T	C	2: 70,020,446		probably benign	Het
Vmn1r17	A	C	6: 57,360,475	F253V	possibly damaging	Het
Vmn1r201	G	T	13: 22,475,452	A279S	possibly damaging	Het
Vmn2r17	A	T	5: 109,427,873	R203S	probably benign	Het
Vwa5a	A	G	9: 38,722,630	E43G	probably benign	Het
Wdr86	C	T	5: 24,712,845		probably null	Het
Wdsub1	A	T	2: 59,870,414		probably benign	Het
Zcchc11	T	A	4: 108,526,845		probably benign	Het
Zcchc7	T	C	4: 44,931,039	L76P	probably damaging	Het
Zfp108	G	T	7: 24,260,738	K251N	probably benign	Het
Zfp263	T	C	16: 3,749,128	C148R	probably damaging	Het
Zfp687	A	C	3: 95,010,386	F692V	probably damaging	Het

Other mutations in Cic

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Cic	APN	7	25292124	missense	probably damaging	1.00
IGL01668:Cic	APN	7	25291204	missense	possibly damaging	0.47
IGL02229:Cic	APN	7	25290950	missense	probably damaging	0.96
IGL02506:Cic	APN	7	25290857	missense	probably benign
IGL02794:Cic	APN	7	25285644	missense	probably damaging	1.00
IGL03065:Cic	APN	7	25285821	splice site	probably benign
IGL03304:Cic	APN	7	25284849	missense	probably damaging	1.00
Capuccino	UTSW	7	25287140	missense	probably damaging	0.98
Cassock	UTSW	7	25288913	nonsense	probably null
Monkey	UTSW	7	25287141	missense	probably damaging	1.00
1mM(1):Cic	UTSW	7	25290789	splice site	probably benign
IGL03046:Cic	UTSW	7	25291075	missense	probably damaging	1.00
R0012:Cic	UTSW	7	25287140	missense	probably damaging	0.98
R0012:Cic	UTSW	7	25287141	missense	probably damaging	1.00
R0027:Cic	UTSW	7	25287140	missense	probably damaging	0.98
R0027:Cic	UTSW	7	25287141	missense	probably damaging	1.00
R0038:Cic	UTSW	7	25287140	missense	probably damaging	0.98
R0038:Cic	UTSW	7	25287141	missense	probably damaging	1.00
R0063:Cic	UTSW	7	25287140	missense	probably damaging	0.98
R0063:Cic	UTSW	7	25287141	missense	probably damaging	1.00
R0064:Cic	UTSW	7	25287140	missense	probably damaging	0.98
R0064:Cic	UTSW	7	25287141	missense	probably damaging	1.00
R0118:Cic	UTSW	7	25286034	missense	probably damaging	1.00
R0193:Cic	UTSW	7	25287140	missense	probably damaging	0.98
R0193:Cic	UTSW	7	25287141	missense	probably damaging	1.00
R0241:Cic	UTSW	7	25287140	missense	probably damaging	0.98
R0241:Cic	UTSW	7	25287141	missense	probably damaging	1.00
R0377:Cic	UTSW	7	25285799	missense	probably damaging	0.98
R0462:Cic	UTSW	7	25287140	missense	probably damaging	0.98
R0462:Cic	UTSW	7	25287141	missense	probably damaging	1.00
R0800:Cic	UTSW	7	25285237	missense	probably benign
R1253:Cic	UTSW	7	25290948	missense	probably damaging	1.00
R1458:Cic	UTSW	7	25279737	intron	probably benign
R1462:Cic	UTSW	7	25271607	missense	probably damaging	0.98
R1462:Cic	UTSW	7	25271607	missense	probably damaging	0.98
R1519:Cic	UTSW	7	25293810	critical splice acceptor site	probably null
R1586:Cic	UTSW	7	25285961	missense	probably damaging	1.00
R1824:Cic	UTSW	7	25288266	missense	probably damaging	1.00
R1908:Cic	UTSW	7	25286840	missense	probably damaging	1.00
R2045:Cic	UTSW	7	25271536	missense	possibly damaging	0.53
R2063:Cic	UTSW	7	25273451	missense	probably damaging	0.98
R2161:Cic	UTSW	7	25288134	splice site	probably null
R2495:Cic	UTSW	7	25291776	splice site	probably benign
R2865:Cic	UTSW	7	25273221	missense	probably damaging	0.96
R3692:Cic	UTSW	7	25288913	nonsense	probably null
R3709:Cic	UTSW	7	25286981	missense	probably damaging	0.99
R3710:Cic	UTSW	7	25286981	missense	probably damaging	0.99
R3872:Cic	UTSW	7	25271699	missense	possibly damaging	0.92
R3946:Cic	UTSW	7	25272346	missense	possibly damaging	0.93
R4199:Cic	UTSW	7	25291670	frame shift	probably null
R4426:Cic	UTSW	7	25294008	utr 3 prime	probably benign
R4502:Cic	UTSW	7	25288467	missense	probably damaging	1.00
R4585:Cic	UTSW	7	25272778	missense	probably benign	0.33
R4586:Cic	UTSW	7	25272778	missense	probably benign	0.33
R4614:Cic	UTSW	7	25291670	frame shift	probably null
R4664:Cic	UTSW	7	25290674	small deletion	probably benign
R4688:Cic	UTSW	7	25291670	frame shift	probably null
R4695:Cic	UTSW	7	25273588	missense	possibly damaging	0.72
R4696:Cic	UTSW	7	25288483	missense	probably benign
R4746:Cic	UTSW	7	25288480	missense	probably damaging	1.00
R4758:Cic	UTSW	7	25292211	missense	possibly damaging	0.62
R4767:Cic	UTSW	7	25271600	missense	possibly damaging	0.92
R4776:Cic	UTSW	7	25282883	missense	possibly damaging	0.95
R4820:Cic	UTSW	7	25271732	missense	possibly damaging	0.92
R4850:Cic	UTSW	7	25272902	missense	probably damaging	0.98
R4851:Cic	UTSW	7	25272902	missense	probably damaging	0.98
R4922:Cic	UTSW	7	25291670	small insertion	probably benign
R5131:Cic	UTSW	7	25291670	small insertion	probably benign
R5718:Cic	UTSW	7	25272778	missense	probably benign	0.33
R5801:Cic	UTSW	7	25271438	missense	possibly damaging	0.93
R5949:Cic	UTSW	7	25272305	missense	probably damaging	1.00
R6000:Cic	UTSW	7	25271998	missense	probably benign	0.33
R6246:Cic	UTSW	7	25271642	missense	probably damaging	1.00
R6283:Cic	UTSW	7	25286034	missense	probably damaging	1.00
R6364:Cic	UTSW	7	25272823	missense	possibly damaging	0.72
R6481:Cic	UTSW	7	25288281	missense	possibly damaging	0.56
R6919:Cic	UTSW	7	25271777	missense	probably benign	0.04
R6920:Cic	UTSW	7	25290682	missense	probably damaging	1.00
R6995:Cic	UTSW	7	25271311	missense	possibly damaging	0.53
R7002:Cic	UTSW	7	25272196	missense	probably damaging	0.99
R7113:Cic	UTSW	7	25273444	missense	probably benign	0.08
R7560:Cic	UTSW	7	25272853	missense	probably damaging	0.98
R7680:Cic	UTSW	7	25292431	missense	probably damaging	0.96
R7698:Cic	UTSW	7	25273172	missense	possibly damaging	0.72
R7746:Cic	UTSW	7	25288782	missense	probably damaging	1.00
R7841:Cic	UTSW	7	25285767	missense	probably damaging	1.00
R7879:Cic	UTSW	7	25285126	missense	probably benign	0.10
R7916:Cic	UTSW	7	25288290	missense	probably damaging	0.99
R7920:Cic	UTSW	7	25271959	missense	probably benign
R8056:Cic	UTSW	7	25290941	missense	possibly damaging	0.90
R8226:Cic	UTSW	7	25287788	missense	probably damaging	1.00
R8281:Cic	UTSW	7	25271824	missense	probably benign
V7732:Cic	UTSW	7	25292245	missense	probably benign
Z1176:Cic	UTSW	7	25271019	missense	possibly damaging	0.91

Predicted Primers

PCR Primer
(F):5'- TTTGAGCTCGGACACCAAG -3'
(R):5'- GCTCCTCATCACTGGTCATG -3'

Sequencing Primer
(F):5'- TCGGACACCAAGGTTCCAG -3'
(R):5'- GGTCATGTCCTCACTGGCTG -3'

Posted On

2016-05-10