Incidental Mutation 'R5094:Agap3'
ID 387981
Institutional Source Beutler Lab
Gene Symbol Agap3
Ensembl Gene ENSMUSG00000023353
Gene Name ArfGAP with GTPase domain, ankyrin repeat and PH domain 3
Synonyms Crag, Centg3, MRIP-1
MMRRC Submission 042683-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.128) question?
Stock # R5094 (G1)
Quality Score 182
Status Validated
Chromosome 5
Chromosomal Location 24452177-24502047 bp(+) (GRCm38)
Type of Mutation unclassified
DNA Base Change (assembly) T to C at 24451321 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148770 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024123] [ENSMUST00000030799] [ENSMUST00000115033] [ENSMUST00000115036] [ENSMUST00000123167] [ENSMUST00000127194] [ENSMUST00000212381]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000024123
SMART Domains Protein: ENSMUSP00000024123
Gene: ENSMUSG00000023353

DomainStartEndE-ValueType
low complexity region 4 59 N/A INTRINSIC
Pfam:Ras 128 286 1.2e-18 PFAM
low complexity region 328 345 N/A INTRINSIC
PH 403 642 2.76e-16 SMART
ArfGap 661 781 9.17e-51 SMART
ANK 820 849 2.43e1 SMART
ANK 853 885 9.17e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000030799
SMART Domains Protein: ENSMUSP00000030799
Gene: ENSMUSG00000028958

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 39 52 N/A INTRINSIC
UBQ 102 171 4.58e-4 SMART
transmembrane domain 190 212 N/A INTRINSIC
transmembrane domain 219 241 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115033
SMART Domains Protein: ENSMUSP00000110685
Gene: ENSMUSG00000028958

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 39 52 N/A INTRINSIC
UBQ 102 171 4.58e-4 SMART
transmembrane domain 190 212 N/A INTRINSIC
transmembrane domain 219 241 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115036
SMART Domains Protein: ENSMUSP00000110688
Gene: ENSMUSG00000028958

DomainStartEndE-ValueType
transmembrane domain 26 45 N/A INTRINSIC
low complexity region 54 67 N/A INTRINSIC
UBQ 117 186 4.58e-4 SMART
low complexity region 190 206 N/A INTRINSIC
transmembrane domain 207 229 N/A INTRINSIC
transmembrane domain 234 256 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123167
SMART Domains Protein: ENSMUSP00000122487
Gene: ENSMUSG00000028958

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 39 52 N/A INTRINSIC
Blast:UBQ 102 122 2e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000127194
SMART Domains Protein: ENSMUSP00000123173
Gene: ENSMUSG00000028958

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 39 52 N/A INTRINSIC
UBQ 102 171 4.58e-4 SMART
low complexity region 175 204 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193014
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195796
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198276
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199647
Predicted Effect probably benign
Transcript: ENSMUST00000212381
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.9%
Validation Efficiency 91% (40/44)
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik G T 15: 82,062,682 G260V possibly damaging Het
Bicra A G 7: 15,975,371 S1173P probably damaging Het
C3 A T 17: 57,225,033 probably null Het
Cdh18 G A 15: 22,714,539 probably benign Het
Cep290 A G 10: 100,567,030 K2274E probably damaging Het
Cfap54 T C 10: 92,898,999 probably benign Het
Chat T A 14: 32,408,939 I582F probably damaging Het
Chrnb4 T C 9: 55,035,313 I226V probably benign Het
Dnajc2 T C 5: 21,776,732 T139A probably damaging Het
Eml1 T C 12: 108,536,311 F712S probably benign Het
Fgfr1 C T 8: 25,570,165 S524L probably damaging Het
Gimap3 T C 6: 48,765,372 E208G probably damaging Het
Gm12185 T A 11: 48,907,548 D706V probably benign Het
Gucy1a2 T A 9: 3,865,443 V639D probably damaging Het
Hivep2 T C 10: 14,132,149 F1497S probably benign Het
Hunk A G 16: 90,496,666 D612G probably benign Het
Ifit3b T A 19: 34,612,548 S375T possibly damaging Het
Mucl1 A G 15: 103,755,403 S13P possibly damaging Het
Olfr1051 T A 2: 86,276,040 Y149F probably damaging Het
Olfr1135 C T 2: 87,671,830 C179Y possibly damaging Het
Pah T A 10: 87,538,219 Y78* probably null Het
Pex13 A G 11: 23,655,441 V263A probably benign Het
Pfdn2 T A 1: 171,356,499 probably benign Het
Phip C T 9: 82,871,844 V1616I probably benign Het
Pigg A G 5: 108,336,257 S457G possibly damaging Het
Ppp1r13b A G 12: 111,843,610 S97P probably benign Het
Slc22a6 T C 19: 8,626,177 L535P probably damaging Het
Slc5a1 A G 5: 33,158,280 T548A probably damaging Het
Smtnl2 T A 11: 72,400,385 S346C probably damaging Het
Spata31d1a A G 13: 59,705,044 probably null Het
Tlcd2 T C 11: 75,469,814 S228P probably benign Het
Tmem135 A G 7: 89,143,793 L411P probably damaging Het
Tnrc6c T C 11: 117,721,046 V170A probably benign Het
Other mutations in Agap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00574:Agap3 APN 5 24498109 missense probably damaging 0.99
IGL00900:Agap3 APN 5 24476368 splice site probably benign
IGL00966:Agap3 APN 5 24501002 splice site probably benign
IGL02207:Agap3 APN 5 24499936 missense probably benign
IGL02431:Agap3 APN 5 24501012 missense probably damaging 1.00
IGL02601:Agap3 APN 5 24483371 missense possibly damaging 0.67
IGL03090:Agap3 APN 5 24501206 missense possibly damaging 0.91
IGL03131:Agap3 APN 5 24477132 missense probably benign 0.16
IGL03247:Agap3 APN 5 24487822 missense probably damaging 1.00
R0165:Agap3 UTSW 5 24479745 missense probably damaging 0.98
R0344:Agap3 UTSW 5 24451202 unclassified probably benign
R0496:Agap3 UTSW 5 24501243 missense probably damaging 1.00
R0542:Agap3 UTSW 5 24500186 missense possibly damaging 0.95
R1427:Agap3 UTSW 5 24476693 missense probably benign 0.03
R1840:Agap3 UTSW 5 24500231 missense probably damaging 1.00
R1903:Agap3 UTSW 5 24493013 missense probably damaging 1.00
R2101:Agap3 UTSW 5 24487799 missense probably damaging 1.00
R4601:Agap3 UTSW 5 24476408 missense probably damaging 1.00
R4745:Agap3 UTSW 5 24451125 splice site probably null
R4807:Agap3 UTSW 5 24477116 missense probably damaging 1.00
R4808:Agap3 UTSW 5 24501245 missense probably benign
R4916:Agap3 UTSW 5 24478013 missense probably damaging 0.98
R5056:Agap3 UTSW 5 24477862 missense probably damaging 1.00
R5646:Agap3 UTSW 5 24483397 missense probably benign 0.01
R5937:Agap3 UTSW 5 24477817 missense probably damaging 0.99
R6365:Agap3 UTSW 5 24474985 missense probably benign 0.43
R6798:Agap3 UTSW 5 24498282 splice site probably null
R6802:Agap3 UTSW 5 24487793 missense possibly damaging 0.87
R6863:Agap3 UTSW 5 24452463 missense possibly damaging 0.63
R6863:Agap3 UTSW 5 24452464 nonsense probably null
R7039:Agap3 UTSW 5 24483401 missense probably benign 0.01
R7111:Agap3 UTSW 5 24501398 missense probably damaging 1.00
R7313:Agap3 UTSW 5 24452384 missense probably benign 0.25
R7791:Agap3 UTSW 5 24476413 missense probably damaging 1.00
R8124:Agap3 UTSW 5 24478130 missense probably benign 0.02
R8293:Agap3 UTSW 5 24487885 missense probably damaging 1.00
R8907:Agap3 UTSW 5 24474631 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACTGAAGGGTGATCTCTGGC -3'
(R):5'- ACTGATTGGCGGAGAAGCTC -3'

Sequencing Primer
(F):5'- TGATCTCTGGCCCTAGGAAG -3'
(R):5'- GGAGAAGCTCGCCCAGG -3'
Posted On 2016-06-06