Incidental Mutation 'R5035:Slc24a2'
ID389491
Institutional Source Beutler Lab
Gene Symbol Slc24a2
Ensembl Gene ENSMUSG00000037996
Gene Namesolute carrier family 24 (sodium/potassium/calcium exchanger), member 2
Synonyms6330417K15Rik
MMRRC Submission 042626-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.130) question?
Stock #R5035 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location86983124-87230477 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 87011706 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 469 (R469S)
Ref Sequence ENSEMBL: ENSMUSP00000043937 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044990] [ENSMUST00000107155] [ENSMUST00000107157] [ENSMUST00000107158]
Predicted Effect possibly damaging
Transcript: ENSMUST00000044990
AA Change: R469S

PolyPhen 2 Score 0.478 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000043937
Gene: ENSMUSG00000037996
AA Change: R469S

DomainStartEndE-ValueType
transmembrane domain 36 58 N/A INTRINSIC
Pfam:Na_Ca_ex 149 281 3.7e-34 PFAM
low complexity region 445 457 N/A INTRINSIC
transmembrane domain 472 489 N/A INTRINSIC
Pfam:Na_Ca_ex 509 648 8.9e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107155
AA Change: R452S

PolyPhen 2 Score 0.178 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000102773
Gene: ENSMUSG00000037996
AA Change: R452S

DomainStartEndE-ValueType
transmembrane domain 36 58 N/A INTRINSIC
Pfam:Na_Ca_ex 149 281 3.6e-34 PFAM
low complexity region 428 440 N/A INTRINSIC
transmembrane domain 455 472 N/A INTRINSIC
Pfam:Na_Ca_ex 492 631 8.5e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107157
AA Change: R473S

PolyPhen 2 Score 0.178 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000102775
Gene: ENSMUSG00000037996
AA Change: R473S

DomainStartEndE-ValueType
transmembrane domain 36 58 N/A INTRINSIC
Pfam:Na_Ca_ex 139 283 7.2e-32 PFAM
transmembrane domain 476 493 N/A INTRINSIC
Pfam:Na_Ca_ex 503 654 4.4e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107158
AA Change: R518S

PolyPhen 2 Score 0.299 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000102776
Gene: ENSMUSG00000037996
AA Change: R518S

DomainStartEndE-ValueType
transmembrane domain 36 58 N/A INTRINSIC
Pfam:Na_Ca_ex 139 283 8e-32 PFAM
transmembrane domain 521 538 N/A INTRINSIC
Pfam:Na_Ca_ex 548 699 4.9e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140780
Meta Mutation Damage Score 0.1766 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the calcium/cation antiporter superfamily of transport proteins. The encoded protein belongs to the SLC24 branch of exchangers, which can mediate the extrusion of one Ca2+ ion and one K+ ion in exchange for four Na+ ions. This family member is a retinal cone/brain exchanger that can mediate a light-induced decrease in free Ca2+ concentration. This protein may also play a neuroprotective role during ischemic brain injury. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous mutation of this gene results in loss of long term potentiation and an increase in long term depression and deficits in motor learning and spatial working memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acat1 T C 9: 53,583,510 I361V probably benign Het
Afp A G 5: 90,507,905 D583G probably benign Het
Bcas3 C T 11: 85,543,945 A552V probably damaging Het
Bfsp2 T G 9: 103,479,866 T121P probably benign Het
Bicra C T 7: 15,979,424 R951Q possibly damaging Het
Cdc40 G A 10: 40,849,813 T220I probably benign Het
Cdk5rap3 T C 11: 96,916,085 probably benign Het
Clcnka A T 4: 141,395,158 Y179* probably null Het
Creb3l1 T A 2: 91,987,086 I361F probably benign Het
Csmd3 T C 15: 47,590,779 Y3557C probably damaging Het
Dab2ip A G 2: 35,709,941 S190G probably benign Het
Dbx1 T C 7: 49,632,536 H307R unknown Het
Dock8 C A 19: 25,086,207 P258T probably damaging Het
Eml6 T C 11: 29,854,187 I305V probably benign Het
Frem3 T A 8: 80,615,914 F1612Y probably damaging Het
Fubp1 A G 3: 152,214,851 T76A probably benign Het
Glmp G C 3: 88,326,644 probably benign Het
Gm20918 A G Y: 5,045,992 Q183R probably benign Het
Krt28 T C 11: 99,366,824 N397S probably benign Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Map3k13 T C 16: 21,921,671 Y583H probably benign Het
Mcm3 A T 1: 20,803,418 probably benign Het
Misp T C 10: 79,827,956 V588A probably benign Het
Olfr1202 A T 2: 88,818,099 K309N probably benign Het
Olfr348 A G 2: 36,786,891 D122G probably damaging Het
Olfr373 T A 8: 72,100,078 L106H probably damaging Het
Olfr644 G A 7: 104,068,407 T208I possibly damaging Het
Olfr970 G A 9: 39,820,094 A152T possibly damaging Het
Osbpl9 A G 4: 109,066,167 F449L probably damaging Het
Pkhd1l1 A G 15: 44,568,324 D3358G probably damaging Het
Prodh2 A T 7: 30,506,479 S247C possibly damaging Het
Prr23a3 G A 9: 98,865,130 E46K possibly damaging Het
Ptprz1 A G 6: 23,016,215 I837V probably benign Het
Rabgap1l A C 1: 160,724,036 F263V probably damaging Het
Rnf4 A G 5: 34,351,339 K182E probably damaging Het
Speer2 A G 16: 69,857,941 probably null Het
Tcrg-C4 G T 13: 19,352,336 R188L unknown Het
Tg C A 15: 66,681,813 probably null Het
Tns1 G A 1: 73,953,820 probably benign Het
Top2b G T 14: 16,409,966 A878S probably benign Het
Ugt3a2 G A 15: 9,361,618 R160Q probably benign Het
Ush2a G T 1: 188,910,808 L4122F probably damaging Het
Other mutations in Slc24a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01987:Slc24a2 APN 4 87227796 missense probably benign 0.01
IGL02080:Slc24a2 APN 4 87227146 missense probably damaging 1.00
IGL03121:Slc24a2 APN 4 87226906 missense probably benign 0.00
G1patch:Slc24a2 UTSW 4 87226882 critical splice donor site probably null
PIT4403001:Slc24a2 UTSW 4 87032286 missense probably benign 0.45
R0024:Slc24a2 UTSW 4 87028240 unclassified probably benign
R0024:Slc24a2 UTSW 4 87028240 unclassified probably benign
R0372:Slc24a2 UTSW 4 87227292 missense probably damaging 1.00
R1034:Slc24a2 UTSW 4 87032275 missense probably damaging 0.99
R1577:Slc24a2 UTSW 4 86991411 missense probably damaging 1.00
R1776:Slc24a2 UTSW 4 87176289 missense probably benign 0.01
R1955:Slc24a2 UTSW 4 87073244 missense probably damaging 1.00
R2043:Slc24a2 UTSW 4 86996645 missense probably damaging 1.00
R2091:Slc24a2 UTSW 4 87011646 missense probably damaging 1.00
R2114:Slc24a2 UTSW 4 86991355 missense probably benign 0.07
R2921:Slc24a2 UTSW 4 86991354 missense possibly damaging 0.46
R2922:Slc24a2 UTSW 4 86991354 missense possibly damaging 0.46
R2924:Slc24a2 UTSW 4 87011724 missense probably benign 0.34
R3806:Slc24a2 UTSW 4 87227784 missense possibly damaging 0.92
R3933:Slc24a2 UTSW 4 87176185 missense probably benign
R4052:Slc24a2 UTSW 4 87227205 missense probably damaging 1.00
R4207:Slc24a2 UTSW 4 87227205 missense probably damaging 1.00
R4466:Slc24a2 UTSW 4 87227862 utr 5 prime probably benign
R4531:Slc24a2 UTSW 4 86991478 missense possibly damaging 0.91
R4561:Slc24a2 UTSW 4 87227397 missense probably damaging 1.00
R4808:Slc24a2 UTSW 4 87032238 missense probably benign 0.01
R4884:Slc24a2 UTSW 4 86991508 missense probably damaging 0.98
R4893:Slc24a2 UTSW 4 87226908 missense probably damaging 0.98
R4936:Slc24a2 UTSW 4 87227347 missense probably damaging 1.00
R5171:Slc24a2 UTSW 4 86996634 missense probably benign 0.40
R5369:Slc24a2 UTSW 4 86991388 missense probably damaging 0.99
R5924:Slc24a2 UTSW 4 87011588 splice site probably null
R6046:Slc24a2 UTSW 4 86996645 missense probably damaging 1.00
R6725:Slc24a2 UTSW 4 87226882 critical splice donor site probably null
R6756:Slc24a2 UTSW 4 87176292 missense probably benign
R7087:Slc24a2 UTSW 4 86991219 splice site probably null
R7804:Slc24a2 UTSW 4 86991537 missense probably damaging 1.00
R8003:Slc24a2 UTSW 4 87176315 missense probably benign 0.04
R8058:Slc24a2 UTSW 4 86991513 missense probably damaging 1.00
R8428:Slc24a2 UTSW 4 87227100 missense probably damaging 1.00
R8529:Slc24a2 UTSW 4 87028280 missense possibly damaging 0.51
X0003:Slc24a2 UTSW 4 86991447 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGTTACATGCATGTCACCTCAC -3'
(R):5'- GGTGCTCTTACAAAAGAAAGCCC -3'

Sequencing Primer
(F):5'- ACCTTTCTCTTTAAACACAACTGG -3'
(R):5'- CCCATGAAGGCAGCTGAG -3'
Posted On2016-06-06