Mutagenetix > Incidental Mutation

Incidental Mutation 'R5031:Tram1l1'

391680

Institutional Source

Beutler Lab

Gene Symbol

Tram1l1

Ensembl Gene

ENSMUSG00000044528

Gene Name

translocation associated membrane protein 1-like 1

Synonyms

MMRRC Submission

042622-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.089) question?

Stock #

R5031 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

124320855-124324743 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 124321644 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Stop codon at position 151 (L151*)

Ref Sequence

ENSEMBL: ENSMUSP00000062635 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000058994]

AlphaFold

Q8QZR0

Predicted Effect

probably null
Transcript: ENSMUST00000058994
AA Change: L151*

SMART Domains

Protein: ENSMUSP00000062635
Gene: ENSMUSG00000044528
AA Change: L151*

Domain	Start	End	E-Value	Type
Pfam:TRAM1	47	114	4.2e-21	PFAM
TLC	116	324	1.73e-47	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000196150

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 95.7%
20x: 89.9%

Validation Efficiency

100% (52/52)

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310035C23Rik	A	G	1: 105,664,514	N136S	probably damaging	Het
Abca13	A	T	11: 9,297,678	N2475I	probably damaging	Het
Acnat2	T	C	4: 49,380,631	K231R	probably damaging	Het
Ank1	C	T	8: 23,099,680	P599L	probably damaging	Het
Arhgef19	A	G	4: 141,250,810	E580G	probably damaging	Het
Atr	A	G	9: 95,865,702	K346E	probably damaging	Het
AU021092	T	C	16: 5,212,604	K309E	probably damaging	Het
Baz2b	T	C	2: 59,912,807	R1607G	probably benign	Het
Cct8	C	T	16: 87,487,538	V254M	probably damaging	Het
Cdca2	T	A	14: 67,713,153	I110F	probably damaging	Het
Csmd3	A	T	15: 47,659,192	C2694S	probably damaging	Het
Dmkn	A	G	7: 30,764,236	I105V	probably benign	Het
Dock1	A	G	7: 135,152,246	D1584G	probably benign	Het
Epg5	G	A	18: 78,028,948	V2392I	probably benign	Het
Gm4787	G	C	12: 81,377,830	T518S	probably benign	Het
Gsap	G	A	5: 21,242,826	S294N	possibly damaging	Het
Hectd2	A	G	19: 36,599,604	N142D	probably damaging	Het
Hmcn1	A	G	1: 150,588,257	C5091R	probably damaging	Het
Ifitm5	G	A	7: 140,950,104	R36*	probably null	Het
Ints2	G	A	11: 86,256,200	P40L	probably damaging	Het
Irs1	A	T	1: 82,286,967	L1176*	probably null	Het
Klhl29	C	T	12: 5,091,334	R550Q	probably benign	Het
Kyat1	A	G	2: 30,188,090	M134T	probably damaging	Het
Lrrk2	A	T	15: 91,700,619	N384Y	possibly damaging	Het
Magel2	T	C	7: 62,380,104	S919P	unknown	Het
Mettl16	A	T	11: 74,802,999	I279F	probably benign	Het
Mrgpra1	A	T	7: 47,335,237	Y231*	probably null	Het
Mroh2a	GCCC	GC	1: 88,232,257		probably null	Het
Mut	T	C	17: 40,938,827	F231S	possibly damaging	Het
Mvp	A	C	7: 126,993,616	Y374*	probably null	Het
Nabp2	G	A	10: 128,409,628		probably benign	Het
Nos1	C	T	5: 117,879,313	P247L	probably benign	Het
Olfr1015	T	A	2: 85,785,718	L69*	probably null	Het
Olfr1115	C	A	2: 87,252,082	F48L	probably benign	Het
Pik3cb	C	T	9: 99,071,408	D441N	probably damaging	Het
Qrich1	C	T	9: 108,541,736	P464S	possibly damaging	Het
Rab17	A	T	1: 90,960,138		probably null	Het
Rspo3	A	T	10: 29,506,447	L77H	probably damaging	Het
Spn	G	T	7: 127,137,230	T35K	probably benign	Het
Sult1d1	T	A	5: 87,559,844	Y139F	possibly damaging	Het
Tbc1d32	C	A	10: 56,123,531	Q848H	probably damaging	Het
Tcaf3	A	G	6: 42,596,933	V115A	probably benign	Het
Trappc12	T	A	12: 28,692,513	I682L	possibly damaging	Het
Trav6d-4	A	C	14: 52,753,599	T31P	probably damaging	Het
Trpm8	A	G	1: 88,348,188	T503A	probably benign	Het
Virma	T	A	4: 11,542,116	Y1567*	probably null	Het
Vmn1r228	T	A	17: 20,776,681	K192*	probably null	Het
Zfp521	T	A	18: 13,844,273	T1028S	possibly damaging	Het
Zfp583	T	A	7: 6,317,398	Q205L	probably benign	Het

Other mutations in Tram1l1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01293:Tram1l1	APN	3	124322139	missense	probably benign	0.00
IGL02385:Tram1l1	APN	3	124322058	missense	probably benign	0.25
IGL03212:Tram1l1	APN	3	124321914	missense	possibly damaging	0.89
R1440:Tram1l1	UTSW	3	124321931	nonsense	probably null
R1929:Tram1l1	UTSW	3	124321986	missense	probably damaging	1.00
R2007:Tram1l1	UTSW	3	124321839	missense	possibly damaging	0.89
R4623:Tram1l1	UTSW	3	124321860	missense	possibly damaging	0.47
R5091:Tram1l1	UTSW	3	124321751	missense	possibly damaging	0.69
R6142:Tram1l1	UTSW	3	124321443	missense	probably damaging	1.00
R7469:Tram1l1	UTSW	3	124321240	missense	probably benign	0.02
R7565:Tram1l1	UTSW	3	124321907	missense	probably damaging	0.99
R7686:Tram1l1	UTSW	3	124321310	missense	probably benign	0.07
R7841:Tram1l1	UTSW	3	124321704	missense	probably damaging	1.00
R7841:Tram1l1	UTSW	3	124321705	missense	probably damaging	1.00
R8139:Tram1l1	UTSW	3	124321787	missense	probably benign	0.10
R8174:Tram1l1	UTSW	3	124322262	missense	probably benign	0.00
R9194:Tram1l1	UTSW	3	124321488	missense	possibly damaging	0.60
R9360:Tram1l1	UTSW	3	124322250	missense	probably damaging	1.00
X0062:Tram1l1	UTSW	3	124322094	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TACATGCTGGTGGCCATCATC -3'
(R):5'- CCCAAGTGGTTCAAGTACAAGAG -3'

Sequencing Primer
(F):5'- GTGGCCATCATCATCCACG -3'
(R):5'- AGAGATAGGCCCCTCCAATGTG -3'

Posted On

2016-06-06