Mutagenetix > Incidental Mutation

Incidental Mutation 'R5031:2310035C23Rik'

391674

Institutional Source

Beutler Lab

Gene Symbol

2310035C23Rik

Ensembl Gene

ENSMUSG00000026319

Gene Name

RIKEN cDNA 2310035C23 gene

Synonyms

MMRRC Submission

042622-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.440) question?

Stock #

R5031 (G1)

Quality Score

212

Status

Validated

Chromosome

Chromosomal Location

105663861-105755191 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 105664514 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 136 (N136S)

Ref Sequence

ENSEMBL: ENSMUSP00000141162 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039173] [ENSMUST00000086721] [ENSMUST00000186485] [ENSMUST00000186807] [ENSMUST00000187537] [ENSMUST00000190501] [ENSMUST00000190811]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000039173
AA Change: N136S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000039178
Gene: ENSMUSG00000026319
AA Change: N136S

Domain	Start	End	E-Value	Type
low complexity region	7	14	N/A	INTRINSIC
low complexity region	20	28	N/A	INTRINSIC
low complexity region	35	47	N/A	INTRINSIC
low complexity region	76	86	N/A	INTRINSIC
low complexity region	107	119	N/A	INTRINSIC
low complexity region	142	154	N/A	INTRINSIC
LisH	231	263	1.25e-3	SMART
coiled coil region	334	372	N/A	INTRINSIC
SCOP:d1b3ua_	532	1069	4e-22	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000086721
AA Change: N136S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000083926
Gene: ENSMUSG00000026319
AA Change: N136S

Domain	Start	End	E-Value	Type
low complexity region	7	14	N/A	INTRINSIC
low complexity region	20	28	N/A	INTRINSIC
low complexity region	35	47	N/A	INTRINSIC
low complexity region	76	86	N/A	INTRINSIC
low complexity region	107	119	N/A	INTRINSIC
low complexity region	142	154	N/A	INTRINSIC
coiled coil region	197	232	N/A	INTRINSIC
LisH	255	287	1.25e-3	SMART
coiled coil region	358	396	N/A	INTRINSIC
SCOP:d1b3ua_	556	1093	5e-22	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000185209

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000185983

Predicted Effect

probably benign
Transcript: ENSMUST00000186485

SMART Domains

Protein: ENSMUSP00000139638
Gene: ENSMUSG00000056536

Domain	Start	End	E-Value	Type
transmembrane domain	2	24	N/A	INTRINSIC
Pfam:Phosphodiest	109	330	3.7e-11	PFAM
Pfam:Sulfatase	148	334	2.1e-8	PFAM
low complexity region	382	393	N/A	INTRINSIC
Pfam:PigN	430	884	1.5e-141	PFAM
transmembrane domain	893	915	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000186807
AA Change: N136S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000140699
Gene: ENSMUSG00000026319
AA Change: N136S

Domain	Start	End	E-Value	Type
low complexity region	7	14	N/A	INTRINSIC
low complexity region	20	28	N/A	INTRINSIC
low complexity region	35	47	N/A	INTRINSIC
low complexity region	76	86	N/A	INTRINSIC
low complexity region	107	119	N/A	INTRINSIC
low complexity region	142	154	N/A	INTRINSIC
coiled coil region	197	232	N/A	INTRINSIC
LisH	255	287	3.9e-6	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000187537

SMART Domains

Protein: ENSMUSP00000140020
Gene: ENSMUSG00000056536

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
Pfam:Phosphodiest	46	331	1.2e-12	PFAM
Pfam:Sulfatase	146	334	2.9e-6	PFAM
low complexity region	382	393	N/A	INTRINSIC
Pfam:PigN	430	800	5.9e-86	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000187909

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000189091

Predicted Effect

probably damaging
Transcript: ENSMUST00000190501
AA Change: N136S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000141162
Gene: ENSMUSG00000026319
AA Change: N136S

Domain	Start	End	E-Value	Type
low complexity region	7	14	N/A	INTRINSIC
low complexity region	20	28	N/A	INTRINSIC
low complexity region	35	47	N/A	INTRINSIC
low complexity region	76	86	N/A	INTRINSIC
low complexity region	107	119	N/A	INTRINSIC
low complexity region	142	154	N/A	INTRINSIC
LisH	231	263	1.25e-3	SMART
coiled coil region	334	372	N/A	INTRINSIC
SCOP:d1b3ua_	532	1069	4e-22	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000190811

SMART Domains

Protein: ENSMUSP00000140844
Gene: ENSMUSG00000056536

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
Pfam:Phosphodiest	46	331	1.1e-12	PFAM
Pfam:Sulfatase	146	334	2.8e-6	PFAM
low complexity region	382	393	N/A	INTRINSIC
Pfam:PigN	430	794	4.4e-86	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000191150

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000191293

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000191408

Meta Mutation Damage Score

0.1241

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 95.7%
20x: 89.9%

Validation Efficiency

100% (52/52)

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	A	T	11: 9,297,678	N2475I	probably damaging	Het
Acnat2	T	C	4: 49,380,631	K231R	probably damaging	Het
Ank1	C	T	8: 23,099,680	P599L	probably damaging	Het
Arhgef19	A	G	4: 141,250,810	E580G	probably damaging	Het
Atr	A	G	9: 95,865,702	K346E	probably damaging	Het
AU021092	T	C	16: 5,212,604	K309E	probably damaging	Het
Baz2b	T	C	2: 59,912,807	R1607G	probably benign	Het
Cct8	C	T	16: 87,487,538	V254M	probably damaging	Het
Cdca2	T	A	14: 67,713,153	I110F	probably damaging	Het
Csmd3	A	T	15: 47,659,192	C2694S	probably damaging	Het
Dmkn	A	G	7: 30,764,236	I105V	probably benign	Het
Dock1	A	G	7: 135,152,246	D1584G	probably benign	Het
Epg5	G	A	18: 78,028,948	V2392I	probably benign	Het
Gm4787	G	C	12: 81,377,830	T518S	probably benign	Het
Gsap	G	A	5: 21,242,826	S294N	possibly damaging	Het
Hectd2	A	G	19: 36,599,604	N142D	probably damaging	Het
Hmcn1	A	G	1: 150,588,257	C5091R	probably damaging	Het
Ifitm5	G	A	7: 140,950,104	R36*	probably null	Het
Ints2	G	A	11: 86,256,200	P40L	probably damaging	Het
Irs1	A	T	1: 82,286,967	L1176*	probably null	Het
Klhl29	C	T	12: 5,091,334	R550Q	probably benign	Het
Kyat1	A	G	2: 30,188,090	M134T	probably damaging	Het
Lrrk2	A	T	15: 91,700,619	N384Y	possibly damaging	Het
Magel2	T	C	7: 62,380,104	S919P	unknown	Het
Mettl16	A	T	11: 74,802,999	I279F	probably benign	Het
Mrgpra1	A	T	7: 47,335,237	Y231*	probably null	Het
Mroh2a	GCCC	GC	1: 88,232,257		probably null	Het
Mut	T	C	17: 40,938,827	F231S	possibly damaging	Het
Mvp	A	C	7: 126,993,616	Y374*	probably null	Het
Nabp2	G	A	10: 128,409,628		probably benign	Het
Nos1	C	T	5: 117,879,313	P247L	probably benign	Het
Olfr1015	T	A	2: 85,785,718	L69*	probably null	Het
Olfr1115	C	A	2: 87,252,082	F48L	probably benign	Het
Pik3cb	C	T	9: 99,071,408	D441N	probably damaging	Het
Qrich1	C	T	9: 108,541,736	P464S	possibly damaging	Het
Rab17	A	T	1: 90,960,138		probably null	Het
Rspo3	A	T	10: 29,506,447	L77H	probably damaging	Het
Spn	G	T	7: 127,137,230	T35K	probably benign	Het
Sult1d1	T	A	5: 87,559,844	Y139F	possibly damaging	Het
Tbc1d32	C	A	10: 56,123,531	Q848H	probably damaging	Het
Tcaf3	A	G	6: 42,596,933	V115A	probably benign	Het
Tram1l1	T	A	3: 124,321,644	L151*	probably null	Het
Trappc12	T	A	12: 28,692,513	I682L	possibly damaging	Het
Trav6d-4	A	C	14: 52,753,599	T31P	probably damaging	Het
Trpm8	A	G	1: 88,348,188	T503A	probably benign	Het
Virma	T	A	4: 11,542,116	Y1567*	probably null	Het
Vmn1r228	T	A	17: 20,776,681	K192*	probably null	Het
Zfp521	T	A	18: 13,844,273	T1028S	possibly damaging	Het
Zfp583	T	A	7: 6,317,398	Q205L	probably benign	Het

Other mutations in 2310035C23Rik

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00493:2310035C23Rik	APN	1	105696599	splice site	probably benign
IGL02393:2310035C23Rik	APN	1	105687368	missense	probably damaging	1.00
IGL02655:2310035C23Rik	APN	1	105678246	missense	probably damaging	1.00
IGL02992:2310035C23Rik	APN	1	105719464	missense	possibly damaging	0.89
IGL03170:2310035C23Rik	APN	1	105735955	missense	probably damaging	0.99
detention	UTSW	1	105750396	missense	possibly damaging	0.54
hiatus	UTSW	1	105721305	missense	probably benign	0.17
limbo	UTSW	1	105692960	missense	probably benign
IGL03050:2310035C23Rik	UTSW	1	105726381	missense	probably damaging	0.98
R0022:2310035C23Rik	UTSW	1	105691902	splice site	probably benign
R0399:2310035C23Rik	UTSW	1	105750959	splice site	probably benign
R1243:2310035C23Rik	UTSW	1	105750364	missense	probably damaging	1.00
R1563:2310035C23Rik	UTSW	1	105719534	missense	probably damaging	1.00
R1760:2310035C23Rik	UTSW	1	105719444	splice site	probably benign
R1894:2310035C23Rik	UTSW	1	105664576	missense	probably benign	0.12
R2036:2310035C23Rik	UTSW	1	105743254	missense	probably damaging	1.00
R2428:2310035C23Rik	UTSW	1	105746126	missense	possibly damaging	0.88
R2905:2310035C23Rik	UTSW	1	105691994	missense	probably benign	0.04
R3121:2310035C23Rik	UTSW	1	105725799	missense	probably benign	0.15
R3750:2310035C23Rik	UTSW	1	105753577	missense	probably damaging	1.00
R3886:2310035C23Rik	UTSW	1	105692213	missense	probably benign	0.14
R4284:2310035C23Rik	UTSW	1	105721287	missense	probably damaging	0.98
R4671:2310035C23Rik	UTSW	1	105718859	missense	probably benign	0.00
R4706:2310035C23Rik	UTSW	1	105692279	missense	probably benign	0.28
R4760:2310035C23Rik	UTSW	1	105721305	missense	probably benign	0.17
R4776:2310035C23Rik	UTSW	1	105719535	nonsense	probably null
R5051:2310035C23Rik	UTSW	1	105691986	missense	possibly damaging	0.85
R5085:2310035C23Rik	UTSW	1	105678180	missense	probably damaging	0.99
R5104:2310035C23Rik	UTSW	1	105731240	missense	probably benign	0.45
R5187:2310035C23Rik	UTSW	1	105718809	nonsense	probably null
R5259:2310035C23Rik	UTSW	1	105721376	missense	probably benign	0.01
R5435:2310035C23Rik	UTSW	1	105741250	intron	probably benign
R5444:2310035C23Rik	UTSW	1	105726384	missense	possibly damaging	0.60
R5490:2310035C23Rik	UTSW	1	105719501	missense	probably damaging	0.99
R5513:2310035C23Rik	UTSW	1	105750973	missense	probably damaging	0.99
R5556:2310035C23Rik	UTSW	1	105693167	missense	probably benign
R5734:2310035C23Rik	UTSW	1	105703883	intron	probably benign
R5779:2310035C23Rik	UTSW	1	105687347	missense	probably damaging	1.00
R5822:2310035C23Rik	UTSW	1	105718856	missense	probably damaging	1.00
R5878:2310035C23Rik	UTSW	1	105692960	missense	probably benign
R6015:2310035C23Rik	UTSW	1	105691958	missense	probably damaging	1.00
R6051:2310035C23Rik	UTSW	1	105721272	missense	probably damaging	1.00
R6266:2310035C23Rik	UTSW	1	105731282	critical splice donor site	probably null
R6556:2310035C23Rik	UTSW	1	105726440	missense	probably damaging	1.00
R6571:2310035C23Rik	UTSW	1	105692982	missense	probably benign
R6612:2310035C23Rik	UTSW	1	105692007	missense	possibly damaging	0.72
R6852:2310035C23Rik	UTSW	1	105753595	missense	probably damaging	1.00
R7209:2310035C23Rik	UTSW	1	105750357	missense	probably damaging	1.00
R7284:2310035C23Rik	UTSW	1	105734583	missense	probably benign	0.01
R7292:2310035C23Rik	UTSW	1	105721416	critical splice donor site	probably null
R7534:2310035C23Rik	UTSW	1	105741023	missense	probably benign	0.01
R7740:2310035C23Rik	UTSW	1	105731261	missense	probably damaging	1.00
R8036:2310035C23Rik	UTSW	1	105678177	missense	probably damaging	1.00
R8234:2310035C23Rik	UTSW	1	105753510	missense	possibly damaging	0.93
R8797:2310035C23Rik	UTSW	1	105750396	missense	possibly damaging	0.54
R8819:2310035C23Rik	UTSW	1	105726454	missense	possibly damaging	0.91
R8820:2310035C23Rik	UTSW	1	105726454	missense	possibly damaging	0.91
R8880:2310035C23Rik	UTSW	1	105664495	missense	probably damaging	0.99
R9173:2310035C23Rik	UTSW	1	105750403	missense	probably benign
R9229:2310035C23Rik	UTSW	1	105686984	missense	possibly damaging	0.95
R9307:2310035C23Rik	UTSW	1	105687352	missense	probably benign	0.02
R9334:2310035C23Rik	UTSW	1	105726454	missense	possibly damaging	0.91
R9412:2310035C23Rik	UTSW	1	105734563	missense	probably benign	0.09
R9467:2310035C23Rik	UTSW	1	105741314	missense	probably damaging	0.99
R9509:2310035C23Rik	UTSW	1	105686979	missense	probably damaging	1.00
R9562:2310035C23Rik	UTSW	1	105664151	missense	probably damaging	0.99
R9565:2310035C23Rik	UTSW	1	105664151	missense	probably damaging	0.99
Z1176:2310035C23Rik	UTSW	1	105719615	missense	probably benign	0.14

Predicted Primers

PCR Primer
(F):5'- TAGATCCTGGTTCTGCAGGC -3'
(R):5'- TTCTCAAGACGACCCTAGACTCAG -3'

Sequencing Primer
(F):5'- CTCGCTGTGGAGATGTCC -3'
(R):5'- GACCCTAGACTCAGTACCCG -3'

Posted On

2016-06-06