Incidental Mutation 'R5111:Vmn2r93'
ID393878
Institutional Source Beutler Lab
Gene Symbol Vmn2r93
Ensembl Gene ENSMUSG00000079698
Gene Namevomeronasal 2, receptor 93
SynonymsEG627132
MMRRC Submission 042699-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R5111 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location18298099-18331914 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 18326064 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 733 (I733F)
Ref Sequence ENSEMBL: ENSMUSP00000078200 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079206] [ENSMUST00000231879] [ENSMUST00000231938]
Predicted Effect probably damaging
Transcript: ENSMUST00000079206
AA Change: I733F

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000078200
Gene: ENSMUSG00000079698
AA Change: I733F

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 82 453 5.9e-40 PFAM
Pfam:NCD3G 509 562 2.6e-21 PFAM
Pfam:7tm_3 594 830 1.5e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000231879
Predicted Effect probably benign
Transcript: ENSMUST00000231938
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.0%
Validation Efficiency 100% (56/56)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd17c A T 7: 84,151,438 L136* probably null Het
Ankrd17 A T 5: 90,242,999 S2271T possibly damaging Het
Arhgef10 A G 8: 14,932,408 D179G probably benign Het
Bcan G T 3: 87,994,207 S396Y probably damaging Het
Btbd3 T A 2: 138,278,909 M1K probably null Het
Capns1 A G 7: 30,192,519 V106A probably benign Het
Ccnjl A G 11: 43,556,717 T76A probably benign Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Col6a6 C T 9: 105,709,474 V1783I possibly damaging Het
Crisp3 T C 17: 40,225,804 T207A possibly damaging Het
Crxos G A 7: 15,896,217 probably benign Het
Csf3r T C 4: 126,030,068 probably null Het
Cyp2a12 A G 7: 27,036,621 Y485C possibly damaging Het
Echdc2 A T 4: 108,169,797 probably benign Het
Elp3 A C 14: 65,560,236 Y329D probably damaging Het
Fbxw16 T C 9: 109,436,728 D341G probably benign Het
H2-Ab1 T A 17: 34,267,482 S172T probably damaging Het
Hyal2 T C 9: 107,571,111 V321A probably benign Het
Ighv6-3 A T 12: 114,391,774 S98R probably benign Het
Kank3 A G 17: 33,818,181 E153G possibly damaging Het
Klrb1c C T 6: 128,786,005 R83H probably benign Het
Krtap16-1 T C 11: 99,986,552 K9E possibly damaging Het
Liph G A 16: 21,984,070 S83F probably damaging Het
Lnpep A G 17: 17,578,610 I261T possibly damaging Het
Mdm2 A T 10: 117,691,221 V273D possibly damaging Het
Mterf1a A G 5: 3,891,860 S3P probably benign Het
Myt1 A G 2: 181,795,885 T172A probably benign Het
Nufip2 T A 11: 77,691,843 S194R probably benign Het
Nusap1 T A 2: 119,630,356 L110* probably null Het
Palb2 A T 7: 122,117,305 C488* probably null Het
Pcdhac1 A T 18: 37,091,505 N457I probably damaging Het
Per1 A T 11: 69,100,786 S49C probably damaging Het
Ppargc1b A T 18: 61,310,487 I535N probably damaging Het
Rb1cc1 T C 1: 6,214,634 probably benign Het
Rpap1 A T 2: 119,771,247 L744Q probably damaging Het
Sdk1 A G 5: 142,127,845 E1549G probably damaging Het
Tnr C T 1: 159,886,228 T742I probably benign Het
Trp53bp1 A T 2: 121,211,387 H1229Q probably damaging Het
Unc80 A G 1: 66,527,995 H920R possibly damaging Het
Urb1 A C 16: 90,752,017 S2268A probably benign Het
Usp32 A T 11: 85,077,331 Y169N possibly damaging Het
Vmn2r18 A T 5: 151,562,448 M527K possibly damaging Het
Vstm2l A G 2: 157,935,469 D89G probably damaging Het
Zdhhc8 G T 16: 18,226,748 Q303K probably benign Het
Zfand2a A G 5: 139,473,754 V159A probably benign Het
Zswim6 A G 13: 107,728,635 noncoding transcript Het
Other mutations in Vmn2r93
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Vmn2r93 APN 17 18326242 missense probably damaging 1.00
IGL01326:Vmn2r93 APN 17 18316644 missense possibly damaging 0.92
IGL01328:Vmn2r93 APN 17 18325557 missense probably benign 0.00
IGL01360:Vmn2r93 APN 17 18305248 missense possibly damaging 0.71
IGL01382:Vmn2r93 APN 17 18313316 nonsense probably null
IGL01463:Vmn2r93 APN 17 18304888 missense probably damaging 1.00
IGL02057:Vmn2r93 APN 17 18325770 missense probably damaging 1.00
IGL02257:Vmn2r93 APN 17 18325508 unclassified probably benign
IGL02686:Vmn2r93 APN 17 18313264 missense possibly damaging 0.89
IGL02720:Vmn2r93 APN 17 18305034 missense probably damaging 1.00
IGL03328:Vmn2r93 APN 17 18304958 missense probably damaging 1.00
PIT4576001:Vmn2r93 UTSW 17 18313211 missense probably benign
R0067:Vmn2r93 UTSW 17 18326410 missense probably benign 0.00
R0067:Vmn2r93 UTSW 17 18326410 missense probably benign 0.00
R0240:Vmn2r93 UTSW 17 18304799 missense probably benign 0.00
R0240:Vmn2r93 UTSW 17 18304799 missense probably benign 0.00
R0488:Vmn2r93 UTSW 17 18326049 missense probably damaging 1.00
R0667:Vmn2r93 UTSW 17 18326241 missense probably damaging 1.00
R0668:Vmn2r93 UTSW 17 18298405 missense probably benign 0.00
R0850:Vmn2r93 UTSW 17 18305017 missense possibly damaging 0.93
R0924:Vmn2r93 UTSW 17 18304181 missense probably benign
R0947:Vmn2r93 UTSW 17 18304081 missense probably benign 0.06
R1124:Vmn2r93 UTSW 17 18298448 missense probably benign 0.00
R1584:Vmn2r93 UTSW 17 18305151 missense possibly damaging 0.84
R1943:Vmn2r93 UTSW 17 18325801 missense probably benign 0.04
R2012:Vmn2r93 UTSW 17 18316578 missense probably benign 0.01
R2018:Vmn2r93 UTSW 17 18326062 missense probably damaging 1.00
R2196:Vmn2r93 UTSW 17 18305166 missense probably damaging 1.00
R2373:Vmn2r93 UTSW 17 18298403 missense probably benign
R2864:Vmn2r93 UTSW 17 18326061 missense probably damaging 1.00
R4276:Vmn2r93 UTSW 17 18304830 missense possibly damaging 0.47
R4446:Vmn2r93 UTSW 17 18304050 missense possibly damaging 0.93
R4537:Vmn2r93 UTSW 17 18304932 missense possibly damaging 0.86
R4674:Vmn2r93 UTSW 17 18304993 missense probably benign 0.34
R4726:Vmn2r93 UTSW 17 18316698 missense probably damaging 1.00
R4936:Vmn2r93 UTSW 17 18304065 missense possibly damaging 0.95
R4984:Vmn2r93 UTSW 17 18313127 splice site probably null
R5749:Vmn2r93 UTSW 17 18298284 missense probably benign 0.06
R5918:Vmn2r93 UTSW 17 18325768 missense probably damaging 1.00
R5921:Vmn2r93 UTSW 17 18325768 missense probably damaging 1.00
R6091:Vmn2r93 UTSW 17 18325696 missense probably benign 0.06
R6283:Vmn2r93 UTSW 17 18304104 missense probably benign 0.02
R6680:Vmn2r93 UTSW 17 18316658 nonsense probably null
R6876:Vmn2r93 UTSW 17 18305188 missense probably benign 0.00
R6963:Vmn2r93 UTSW 17 18316587 missense probably damaging 1.00
R6996:Vmn2r93 UTSW 17 18304641 missense probably damaging 1.00
R7027:Vmn2r93 UTSW 17 18313286 missense probably benign 0.01
R7034:Vmn2r93 UTSW 17 18326410 missense probably benign 0.00
R7036:Vmn2r93 UTSW 17 18326410 missense probably benign 0.00
R7246:Vmn2r93 UTSW 17 18325750 missense possibly damaging 0.89
R7258:Vmn2r93 UTSW 17 18305141 missense probably benign 0.32
R7323:Vmn2r93 UTSW 17 18313235 nonsense probably null
R7325:Vmn2r93 UTSW 17 18303987 missense probably benign 0.01
R7390:Vmn2r93 UTSW 17 18305067 missense probably damaging 1.00
R7427:Vmn2r93 UTSW 17 18326410 missense probably benign 0.00
R7428:Vmn2r93 UTSW 17 18326410 missense probably benign 0.00
R7448:Vmn2r93 UTSW 17 18325986 missense probably benign 0.19
R7453:Vmn2r93 UTSW 17 18313318 missense probably benign 0.10
R7562:Vmn2r93 UTSW 17 18298469 missense probably benign 0.01
R7662:Vmn2r93 UTSW 17 18305369 missense probably benign 0.00
R7682:Vmn2r93 UTSW 17 18305321 missense probably benign 0.03
R7704:Vmn2r93 UTSW 17 18316648 missense probably benign 0.01
R7772:Vmn2r93 UTSW 17 18313220 missense probably damaging 0.99
R7957:Vmn2r93 UTSW 17 18325692 nonsense probably null
R8276:Vmn2r93 UTSW 17 18305387 critical splice donor site probably null
R8290:Vmn2r93 UTSW 17 18304029 missense probably damaging 1.00
R8362:Vmn2r93 UTSW 17 18326091 missense probably benign 0.02
R8376:Vmn2r93 UTSW 17 18304968 missense probably damaging 1.00
Z1088:Vmn2r93 UTSW 17 18326403 missense probably damaging 1.00
Z1177:Vmn2r93 UTSW 17 18305338 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCACTGTGTTGGCCAAAG -3'
(R):5'- GGACCTTTCCGTTAGTGCTG -3'

Sequencing Primer
(F):5'- CACTGTGTTGGCCAAAGCTATTACTG -3'
(R):5'- CCGTTAGTGCTGTGGTAGAC -3'
Posted On2016-06-15