Mutagenetix > Incidental Mutations

Incidental Mutation 'R5129:Spata16'

394895

Institutional Source

Beutler Lab

Gene Symbol

Spata16

Ensembl Gene

ENSMUSG00000039335

Gene Name

spermatogenesis associated 16

Synonyms

spermatogenesis-related protein, 4921511F01Rik, 4930503K02Rik, Nyd-sp12

MMRRC Submission

042717-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.138) question?

Stock #

R5129 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

26637620-26983212 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 26667564 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 78 (E78G)

Ref Sequence

ENSEMBL: ENSMUSP00000103941 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047005] [ENSMUST00000108305]

Predicted Effect

probably damaging
Transcript: ENSMUST00000047005
AA Change: E78G

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000043378
Gene: ENSMUSG00000039335
AA Change: E78G

Domain	Start	End	E-Value	Type
Pfam:NYD-SP12_N	5	569	N/A	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000108305
AA Change: E78G

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000103941
Gene: ENSMUSG00000039335
AA Change: E78G

Domain	Start	End	E-Value	Type
Pfam:NYD-SP12_N	1	534	N/A	PFAM

Meta Mutation Damage Score

0.0686

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 93.8%

Validation Efficiency

98% (51/52)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a testis-specific protein that belongs to the tetratricopeptide repeat-like superfamily. The encoded protein localizes to the Golgi apparatus and may play a role in spermatogenesis. [provided by RefSeq, May 2010]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930432E11Rik	A	G	7: 29,561,361		noncoding transcript	Het
Abcf1	C	T	17: 35,960,795		probably benign	Het
Adamts14	T	A	10: 61,249,618	D209V	probably benign	Het
Aldh3b1	A	G	19: 3,915,336	F392L	probably benign	Het
Atp1a2	A	T	1: 172,275,955	D999E	probably benign	Het
Capn7	T	C	14: 31,344,511	V94A	probably damaging	Het
Cdh13	A	G	8: 119,095,215	D271G	probably damaging	Het
Cntnap5b	G	A	1: 100,379,090	G844D	probably damaging	Het
Col6a4	T	C	9: 106,013,377	E1906G	probably damaging	Het
Daw1	T	C	1: 83,205,903	Y225H	probably damaging	Het
Dvl3	T	A	16: 20,517,340	M49K	possibly damaging	Het
Eef1b2	T	G	1: 63,179,580	S175A	probably damaging	Het
Epb41l1	A	T	2: 156,509,281	Y425F	possibly damaging	Het
Fam43b	A	T	4: 138,395,472	L179*	probably null	Het
Fbxw28	A	G	9: 109,326,603	L314P	probably damaging	Het
Fstl4	C	A	11: 53,186,439	D674E	probably damaging	Het
G3bp1	T	C	11: 55,489,116	V92A	possibly damaging	Het
Gm3604	A	T	13: 62,369,774	Y257N	probably benign	Het
Gm5415	C	A	1: 32,545,479	R450M	probably damaging	Het
Gm5415	T	A	1: 32,545,480	R450W	probably damaging	Het
Gm5900	A	G	7: 104,950,016		noncoding transcript	Het
Hectd4	G	A	5: 121,343,510	V3041M	possibly damaging	Het
Hivep2	A	G	10: 14,130,864	K1069E	probably damaging	Het
Hlf	T	C	11: 90,390,252	D38G	probably benign	Het
Hsd3b7	C	A	7: 127,801,134	C18*	probably null	Het
Kdm5a	T	C	6: 120,405,022	C676R	probably damaging	Het
Klhdc7b	A	G	15: 89,388,548	Y1211C	probably damaging	Het
Krt78	C	A	15: 101,947,580	V599L	possibly damaging	Het
Mroh9	C	G	1: 163,060,760	G249R	probably damaging	Het
Nbas	T	C	12: 13,390,960	L1097P	probably damaging	Het
Nf2	A	C	11: 4,816,145	D87E	probably benign	Het
Olfr113	T	C	17: 37,575,180	Y81C	probably damaging	Het
Olfr961	T	A	9: 39,647,494	I256N	probably benign	Het
Ppil3	A	G	1: 58,440,833		probably benign	Het
Prrc2a	T	C	17: 35,160,178	E276G	unknown	Het
Tlr3	A	T	8: 45,402,981	I54K	probably damaging	Het
Tmem72	A	G	6: 116,702,013	L34P	probably damaging	Het
Triobp	A	G	15: 78,961,096	R213G	probably benign	Het
Tyrp1	T	A	4: 80,846,607	V7D	probably damaging	Het
Uhrf2	A	G	19: 30,075,221	I372V	probably benign	Het
Uty	T	C	Y: 1,158,592	T484A	probably benign	Het
Vcan	T	C	13: 89,690,240	D2395G	probably damaging	Het
Vmn1r225	T	A	17: 20,503,116	I273N	probably damaging	Het
Zfp451	C	T	1: 33,802,933		probably benign	Het
Zfp457	T	C	13: 67,293,356	E385G	probably benign	Het
Zfp74	C	T	7: 29,932,455	M121I	probably benign	Het
Zfp866	A	T	8: 69,767,709		probably null	Het
Zfp874a	A	T	13: 67,442,981	C195S	probably damaging	Het

Other mutations in Spata16

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00835:Spata16	APN	3	26924262	missense	probably damaging	0.98
IGL01017:Spata16	APN	3	26840722	missense	possibly damaging	0.93
IGL01129:Spata16	APN	3	26913184	splice site	probably benign
IGL01330:Spata16	APN	3	26914715	missense	probably damaging	0.99
IGL02033:Spata16	APN	3	26913334	critical splice donor site	probably null
IGL02069:Spata16	APN	3	26732795	nonsense	probably null
IGL02231:Spata16	APN	3	26913264	missense	probably damaging	1.00
R0084:Spata16	UTSW	3	26667410	missense	possibly damaging	0.95
R0109:Spata16	UTSW	3	26913267	missense	probably damaging	0.97
R0109:Spata16	UTSW	3	26913267	missense	probably damaging	0.97
R0325:Spata16	UTSW	3	26667456	missense	probably damaging	0.98
R0811:Spata16	UTSW	3	26913338	splice site	probably benign
R2061:Spata16	UTSW	3	26924370	missense	probably damaging	0.99
R3148:Spata16	UTSW	3	26878712	critical splice donor site	probably null
R4837:Spata16	UTSW	3	26732932	missense	possibly damaging	0.93
R4972:Spata16	UTSW	3	26840723	missense	possibly damaging	0.93
R5235:Spata16	UTSW	3	26667632	missense	probably benign	0.00
R5458:Spata16	UTSW	3	26777537	missense	probably damaging	0.99
R6578:Spata16	UTSW	3	26667548	nonsense	probably null
R7069:Spata16	UTSW	3	26927334	missense	probably damaging	0.99
R7256:Spata16	UTSW	3	26667867	missense	probably benign	0.25
R7936:Spata16	UTSW	3	26667423	missense	possibly damaging	0.71
R8015:Spata16	UTSW	3	26667659	missense	probably benign
R8060:Spata16	UTSW	3	26840720	missense	probably damaging	0.99
R8161:Spata16	UTSW	3	26840662	missense	probably benign	0.16
R8459:Spata16	UTSW	3	26667527	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TGAAGAGAGTCTATCGAGATCTGC -3'
(R):5'- AAGGCACATGTTAGGCTGGG -3'

Sequencing Primer
(F):5'- ATCGAGATCTGCTTCTTCCAAAG -3'
(R):5'- TTAGGCTGGGCAAACTCATAGCTC -3'

Posted On

2016-06-21