Incidental Mutation 'R5263:Zranb1'
ID401552
Institutional Source Beutler Lab
Gene Symbol Zranb1
Ensembl Gene ENSMUSG00000030967
Gene Namezinc finger, RAN-binding domain containing 1
Synonyms9330160G10Rik, D7Wsu87e
MMRRC Submission 042831-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.921) question?
Stock #R5263 (G1)
Quality Score217
Status Not validated
Chromosome7
Chromosomal Location132931142-132986391 bp(+) (GRCm38)
Type of Mutationsmall insertion (1 aa in frame mutation)
DNA Base Change (assembly) CTGATGATGATG to CTGATGATGATGATG at 132982827 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148867 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033265] [ENSMUST00000033269] [ENSMUST00000106157] [ENSMUST00000124096] [ENSMUST00000165457] [ENSMUST00000166439] [ENSMUST00000169570] [ENSMUST00000210507] [ENSMUST00000215716]
Predicted Effect probably benign
Transcript: ENSMUST00000033265
SMART Domains Protein: ENSMUSP00000033265
Gene: ENSMUSG00000030967

DomainStartEndE-ValueType
ZnF_RBZ 6 30 9.14e-5 SMART
ZnF_RBZ 86 110 6.56e-6 SMART
ZnF_RBZ 151 175 1.69e-8 SMART
low complexity region 180 195 N/A INTRINSIC
Pfam:OTU 438 586 9.8e-35 PFAM
low complexity region 698 708 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000033269
SMART Domains Protein: ENSMUSP00000033269
Gene: ENSMUSG00000030970

DomainStartEndE-ValueType
Pfam:2-Hacid_dh 36 358 2.9e-31 PFAM
Pfam:2-Hacid_dh_C 139 323 1.7e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106157
SMART Domains Protein: ENSMUSP00000101763
Gene: ENSMUSG00000030967

DomainStartEndE-ValueType
ZnF_RBZ 6 30 9.14e-5 SMART
ZnF_RBZ 86 110 6.56e-6 SMART
ZnF_RBZ 151 175 1.69e-8 SMART
low complexity region 180 195 N/A INTRINSIC
Pfam:OTU 438 586 1.5e-40 PFAM
low complexity region 698 708 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131085
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153335
Predicted Effect probably benign
Transcript: ENSMUST00000165457
Predicted Effect probably benign
Transcript: ENSMUST00000166439
SMART Domains Protein: ENSMUSP00000127448
Gene: ENSMUSG00000030970

DomainStartEndE-ValueType
Pfam:2-Hacid_dh 11 333 2.4e-31 PFAM
Pfam:2-Hacid_dh_C 114 298 1.5e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169570
SMART Domains Protein: ENSMUSP00000130294
Gene: ENSMUSG00000030970

DomainStartEndE-ValueType
Pfam:2-Hacid_dh 579 901 2.8e-31 PFAM
Pfam:2-Hacid_dh_C 682 866 5.6e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000210507
Predicted Effect probably benign
Transcript: ENSMUST00000215716
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased CD4+ T cells and decreased susceptibility to experimental autoimmune encephalomyelitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adh4 G T 3: 138,428,055 V309L probably benign Het
Agmo T C 12: 37,357,681 V188A probably benign Het
Aqr A G 2: 114,116,578 M1041T probably damaging Het
Arhgef4 T A 1: 34,724,997 S1111R possibly damaging Het
Ascc3 A C 10: 50,716,661 E1144D probably benign Het
Cct3 T C 3: 88,321,365 probably null Het
Cd209f T C 8: 4,104,506 T114A probably benign Het
Cgnl1 G A 9: 71,632,654 Q1103* probably null Het
Cop1 G A 1: 159,324,937 D586N probably damaging Het
Dcaf5 A G 12: 80,348,346 S350P probably damaging Het
Dhx29 T C 13: 112,948,221 C658R probably damaging Het
Dync1i1 G A 6: 5,969,446 V424I possibly damaging Het
Gfap C T 11: 102,896,930 R63Q probably damaging Het
Gm10563 CTTT CTTTATTT 4: 155,614,483 probably null Het
Gprc6a C A 10: 51,626,804 G321V probably damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Izumo1r A G 9: 14,901,680 C99R probably damaging Het
Lrp1b T C 2: 41,960,679 D102G probably damaging Het
Mettl4 G A 17: 94,740,509 Q235* probably null Het
Mmrn2 A G 14: 34,399,584 T804A probably benign Het
Mrgprb5 A G 7: 48,168,189 V266A probably damaging Het
Ntng1 T C 3: 109,934,872 D195G probably damaging Het
Pld4 T C 12: 112,765,031 L206P probably damaging Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Prkd1 A G 12: 50,388,306 L546P probably damaging Het
Rhob A T 12: 8,499,232 M134K probably benign Het
Ryr3 A G 2: 112,718,002 S3087P possibly damaging Het
Sema6c T C 3: 95,173,152 L887P probably benign Het
Sltm T C 9: 70,584,799 S648P unknown Het
Sucnr1 A G 3: 60,086,769 I239M possibly damaging Het
Tgtp2 T A 11: 49,059,263 M161L probably damaging Het
Trpm7 A G 2: 126,821,217 V1037A probably benign Het
Vmn2r13 A T 5: 109,173,975 H285Q probably benign Het
Zfp971 T A 2: 178,033,762 C385S probably damaging Het
Zfpm2 T A 15: 41,099,395 V283E probably benign Het
Other mutations in Zranb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Zranb1 APN 7 132982504 splice site probably benign
IGL00843:Zranb1 APN 7 132949893 missense probably benign 0.26
IGL01727:Zranb1 APN 7 132966620 missense probably damaging 1.00
IGL02087:Zranb1 APN 7 132973417 splice site probably benign
IGL02676:Zranb1 APN 7 132966681 missense probably benign 0.16
IGL03081:Zranb1 APN 7 132950397 missense probably damaging 0.99
IGL03095:Zranb1 APN 7 132949906 nonsense probably null
IGL03186:Zranb1 APN 7 132950203 missense possibly damaging 0.68
PIT4151001:Zranb1 UTSW 7 132949994 missense probably benign
R0207:Zranb1 UTSW 7 132950385 missense probably damaging 1.00
R0470:Zranb1 UTSW 7 132982771 missense probably damaging 1.00
R0854:Zranb1 UTSW 7 132949848 missense possibly damaging 0.78
R1318:Zranb1 UTSW 7 132966552 nonsense probably null
R1389:Zranb1 UTSW 7 132971333 missense probably damaging 1.00
R1480:Zranb1 UTSW 7 132950016 missense probably benign 0.39
R1656:Zranb1 UTSW 7 132949767 missense probably benign 0.31
R1956:Zranb1 UTSW 7 132982729 missense probably damaging 1.00
R1958:Zranb1 UTSW 7 132982729 missense probably damaging 1.00
R2010:Zranb1 UTSW 7 132966696 critical splice donor site probably null
R2289:Zranb1 UTSW 7 132950039 missense probably damaging 1.00
R3831:Zranb1 UTSW 7 132982776 missense probably damaging 0.98
R4128:Zranb1 UTSW 7 132966552 nonsense probably null
R4745:Zranb1 UTSW 7 132972714 missense probably damaging 0.97
R5121:Zranb1 UTSW 7 132950187 missense probably benign 0.06
R5262:Zranb1 UTSW 7 132982827 small insertion probably benign
R5264:Zranb1 UTSW 7 132982827 small insertion probably benign
R5522:Zranb1 UTSW 7 132983949 makesense probably null
R6252:Zranb1 UTSW 7 132983904 missense probably benign 0.00
R6519:Zranb1 UTSW 7 132950128 nonsense probably null
R6671:Zranb1 UTSW 7 132971313 missense probably damaging 1.00
R6827:Zranb1 UTSW 7 132949745 missense probably benign 0.17
R6928:Zranb1 UTSW 7 132966594 missense possibly damaging 0.65
R7313:Zranb1 UTSW 7 132982752 missense probably damaging 1.00
R7583:Zranb1 UTSW 7 132983896 missense probably benign 0.00
R8181:Zranb1 UTSW 7 132983779 missense probably damaging 1.00
R8236:Zranb1 UTSW 7 132949664 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCACTTCAGGAGGTGGAAAC -3'
(R):5'- ACTACAGGTGCCATCACTTC -3'

Sequencing Primer
(F):5'- GCCAGGCACTTGCTCCTTG -3'
(R):5'- ATCACTTCTGGGAGGCACATG -3'
Posted On2016-07-06