Incidental Mutation 'R0415:Trove2'
ID40199
Institutional Source Beutler Lab
Gene Symbol Trove2
Ensembl Gene ENSMUSG00000018199
Gene NameTROVE domain family, member 2
Synonyms1810007I17Rik, A530054J02Rik, SS-A/Ro, Ssa, Ssa2
MMRRC Submission 038617-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.225) question?
Stock #R0415 (G1)
Quality Score168
Status Validated
Chromosome1
Chromosomal Location143750790-143777068 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 143760075 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 444 (N444K)
Ref Sequence ENSEMBL: ENSMUSP00000125623 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159879]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000018343
Predicted Effect probably benign
Transcript: ENSMUST00000159879
AA Change: N444K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000125623
Gene: ENSMUSG00000018199
AA Change: N444K

DomainStartEndE-ValueType
Pfam:TROVE 16 369 9.7e-99 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 97% (99/102)
MGI Phenotype PHENOTYPE: Homozygous mutant mice develop symptoms similar to those observed in patients with lupus, including increased photosensitivity and membranoproliferative glomerulonephritis. The production of autoantibodies is detected in both homozygous and heterozygous mutant mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427G23Rik A T 5: 23,831,050 noncoding transcript Het
Acox2 A G 14: 8,243,835 probably benign Het
Adgb T C 10: 10,431,067 probably null Het
Adgra3 C A 5: 49,961,757 probably benign Het
Adgre4 G A 17: 55,852,288 V658I probably benign Het
Ahnak A G 19: 9,012,871 probably benign Het
Anapc2 A G 2: 25,278,325 T159A probably damaging Het
Arfgef3 A G 10: 18,613,127 probably benign Het
Atf7ip C T 6: 136,560,012 S81L possibly damaging Het
Cacna1i A G 15: 80,368,830 probably benign Het
Camk1 A T 6: 113,341,891 Y20* probably null Het
Ccdc40 T C 11: 119,232,118 Y249H possibly damaging Het
Cd109 T A 9: 78,712,615 S1380T probably benign Het
Cfap57 A T 4: 118,569,431 L1107Q possibly damaging Het
Col6a4 C T 9: 106,075,080 V540I probably damaging Het
Cst9 T A 2: 148,838,442 probably benign Het
Cul5 C T 9: 53,667,070 V73I probably benign Het
Cxcl16 T A 11: 70,458,748 K84* probably null Het
Cyp2c29 T C 19: 39,329,095 probably benign Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Dip2c C T 13: 9,568,289 probably benign Het
Dis3 A T 14: 99,087,456 I513N probably damaging Het
Dnajc16 A T 4: 141,789,048 L3* probably null Het
Dopey1 T A 9: 86,506,502 L480M probably damaging Het
Eml6 A G 11: 29,749,392 V1787A possibly damaging Het
Etnk1 A G 6: 143,180,774 N115S probably damaging Het
Fryl T C 5: 73,098,414 Y758C probably damaging Het
Gbp4 G A 5: 105,121,106 R394C possibly damaging Het
Ggnbp2 A C 11: 84,833,225 probably benign Het
Gm7137 A G 10: 77,788,173 probably benign Het
Gstm2 T A 3: 107,984,006 Q132L probably benign Het
Habp2 T C 19: 56,317,717 probably benign Het
Hectd2 T C 19: 36,584,884 probably benign Het
Htr6 A G 4: 139,062,081 I291T possibly damaging Het
Ighg2c T C 12: 113,287,910 D199G unknown Het
Itih2 A G 2: 10,105,615 probably benign Het
Kcnab2 A G 4: 152,395,136 F248S probably benign Het
Kcnc4 T C 3: 107,445,433 K610E probably damaging Het
Kcnk16 T A 14: 20,262,975 probably null Het
Kndc1 C T 7: 139,930,124 T1293I probably damaging Het
Lcp1 A T 14: 75,227,006 I556F possibly damaging Het
Lrrc8d T C 5: 105,811,865 L47P probably damaging Het
Lyst T C 13: 13,711,610 probably benign Het
Macrod2 G A 2: 142,210,145 probably null Het
Micalcl C T 7: 112,381,028 R70C probably damaging Het
Mllt3 ACTGCTGCTGCTGCTGCTGCT ACTGCTGCTGCTGCTGCT 4: 87,841,339 probably benign Het
Msh3 A G 13: 92,346,786 V283A possibly damaging Het
Nup205 T C 6: 35,214,634 probably benign Het
Nxpe2 T C 9: 48,326,614 T114A probably damaging Het
Olfr1023 A T 2: 85,887,438 I213F possibly damaging Het
Olfr1034 A T 2: 86,047,055 H191L probably benign Het
Olfr229 A G 9: 39,909,983 Y60C probably damaging Het
Olfr78 C T 7: 102,742,087 M305I probably benign Het
Olfr893 A T 9: 38,209,973 M305L probably benign Het
Pard3 G A 8: 127,610,566 G1221D probably damaging Het
Pax5 G A 4: 44,691,886 A120V probably damaging Het
Pcsk6 C T 7: 66,033,874 R746C probably damaging Het
Pif1 G A 9: 65,588,051 C81Y probably benign Het
Plcb1 A G 2: 135,337,499 Y609C probably damaging Het
Plcd4 C A 1: 74,552,097 S217Y probably damaging Het
Plxna1 G A 6: 89,357,336 H104Y probably benign Het
Polr2k A G 15: 36,175,456 Y45C probably damaging Het
Pqlc3 C A 12: 16,997,710 probably benign Het
Prex1 A G 2: 166,586,699 probably benign Het
Pth2r A G 1: 65,388,439 M424V probably benign Het
Pygm A G 19: 6,391,366 R464G probably benign Het
Rad51c A G 11: 87,397,655 L234P probably damaging Het
Rnf145 A G 11: 44,525,138 Y60C probably damaging Het
Rnf167 T C 11: 70,649,699 I135T probably damaging Het
Rnf213 A T 11: 119,414,469 I509F probably damaging Het
Ryr2 T C 13: 11,869,156 S213G probably damaging Het
Selenbp1 T C 3: 94,936,913 V27A possibly damaging Het
Selenof T G 3: 144,577,692 L14R probably damaging Het
Sfswap A T 5: 129,504,126 D121V probably damaging Het
Slc25a34 C A 4: 141,620,469 M300I possibly damaging Het
Slc34a3 T G 2: 25,229,110 T583P probably benign Het
Smg1 C A 7: 118,182,468 A1199S probably benign Het
Spint1 A G 2: 119,245,615 T231A probably damaging Het
Sptbn1 A C 11: 30,149,576 N229K probably damaging Het
Sult2b1 A G 7: 45,730,092 probably benign Het
Tas2r123 A T 6: 132,847,838 M233L probably damaging Het
Tbcel C A 9: 42,444,500 C139F probably benign Het
Thbs2 A C 17: 14,679,973 S573A probably benign Het
Tmem132c A G 5: 127,563,705 E980G probably damaging Het
Tmem247 G T 17: 86,922,322 C197F probably damaging Het
Tmem251 T A 12: 102,744,876 Y119* probably null Het
Tmem43 C A 6: 91,482,318 P257Q probably benign Het
Tmprss13 A G 9: 45,337,132 probably null Het
Ubr5 T C 15: 37,972,980 T2626A probably damaging Het
Vmn1r196 T A 13: 22,293,836 V215D probably damaging Het
Vmn1r22 G T 6: 57,900,332 T220K probably benign Het
Vmn2r116 G A 17: 23,387,279 M388I possibly damaging Het
Vmn2r74 A C 7: 85,961,410 C25G probably damaging Het
Xndc1 T C 7: 102,080,616 probably benign Het
Zfp282 T A 6: 47,905,053 I558N possibly damaging Het
Zfp282 A G 6: 47,897,881 D340G probably damaging Het
Zfp316 T A 5: 143,264,491 T56S unknown Het
Zfp345 A G 2: 150,474,559 probably benign Het
Other mutations in Trove2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01563:Trove2 APN 1 143761382 missense probably benign 0.29
IGL01578:Trove2 APN 1 143761300 missense probably damaging 0.99
IGL02006:Trove2 APN 1 143760346 splice site probably benign
IGL02155:Trove2 APN 1 143761269 critical splice donor site probably null
IGL02219:Trove2 APN 1 143761275 missense possibly damaging 0.94
IGL02637:Trove2 APN 1 143770788 missense probably damaging 1.00
IGL03013:Trove2 APN 1 143770708 missense probably damaging 1.00
IGL03075:Trove2 APN 1 143770771 missense probably benign
R0443:Trove2 UTSW 1 143765923 splice site probably benign
R0479:Trove2 UTSW 1 143757751 missense possibly damaging 0.72
R1696:Trove2 UTSW 1 143757837 missense probably damaging 0.99
R1728:Trove2 UTSW 1 143760014 missense probably benign
R1728:Trove2 UTSW 1 143760034 missense probably benign
R1729:Trove2 UTSW 1 143760014 missense probably benign
R1729:Trove2 UTSW 1 143760034 missense probably benign
R1730:Trove2 UTSW 1 143760014 missense probably benign
R1730:Trove2 UTSW 1 143760034 missense probably benign
R1739:Trove2 UTSW 1 143760014 missense probably benign
R1739:Trove2 UTSW 1 143760034 missense probably benign
R1762:Trove2 UTSW 1 143760014 missense probably benign
R1762:Trove2 UTSW 1 143760034 missense probably benign
R1783:Trove2 UTSW 1 143760014 missense probably benign
R1783:Trove2 UTSW 1 143760034 missense probably benign
R1784:Trove2 UTSW 1 143760014 missense probably benign
R1784:Trove2 UTSW 1 143760034 missense probably benign
R1785:Trove2 UTSW 1 143760014 missense probably benign
R1785:Trove2 UTSW 1 143760034 missense probably benign
R1857:Trove2 UTSW 1 143770750 missense probably benign 0.00
R2049:Trove2 UTSW 1 143760034 missense probably benign
R2130:Trove2 UTSW 1 143760034 missense probably benign
R2131:Trove2 UTSW 1 143760034 missense probably benign
R2133:Trove2 UTSW 1 143760034 missense probably benign
R2141:Trove2 UTSW 1 143760034 missense probably benign
R2142:Trove2 UTSW 1 143760034 missense probably benign
R2372:Trove2 UTSW 1 143770882 nonsense probably null
R2929:Trove2 UTSW 1 143757878 missense possibly damaging 0.92
R4191:Trove2 UTSW 1 143770786 missense probably benign 0.00
R5520:Trove2 UTSW 1 143770771 missense probably benign
R5821:Trove2 UTSW 1 143766765 missense probably benign 0.09
R7432:Trove2 UTSW 1 143765810 missense probably benign 0.43
R7658:Trove2 UTSW 1 143770873 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTCAAGTACTGCTGAGCCCACCC -3'
(R):5'- GGTTCCGTTTCCAGTGACTACAGAC -3'

Sequencing Primer
(F):5'- CAGCCTCACTAATGGAGTGTG -3'
(R):5'- GTTTCCAGTGACTACAGACATGAC -3'
Posted On2013-05-23