Incidental Mutation 'R0415:Ccdc40'
ID 40264
Institutional Source Beutler Lab
Gene Symbol Ccdc40
Ensembl Gene ENSMUSG00000039963
Gene Name coiled-coil domain containing 40
Synonyms B930008I02Rik
MMRRC Submission 038617-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.158) question?
Stock # R0415 (G1)
Quality Score 216
Status Validated
Chromosome 11
Chromosomal Location 119119398-119156064 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 119122944 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 249 (Y249H)
Ref Sequence ENSEMBL: ENSMUSP00000062198 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035935] [ENSMUST00000036113] [ENSMUST00000053440] [ENSMUST00000207655]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000035935
AA Change: Y179H

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000039463
Gene: ENSMUSG00000039963
AA Change: Y179H

DomainStartEndE-ValueType
internal_repeat_1 7 48 1.25e-8 PROSPERO
internal_repeat_1 55 96 1.25e-8 PROSPERO
low complexity region 159 170 N/A INTRINSIC
low complexity region 208 232 N/A INTRINSIC
coiled coil region 349 371 N/A INTRINSIC
coiled coil region 423 447 N/A INTRINSIC
Blast:HisKA 450 519 3e-13 BLAST
Blast:HisKA 574 629 5e-8 BLAST
low complexity region 793 805 N/A INTRINSIC
Pfam:BRE1 830 928 4.2e-20 PFAM
coiled coil region 1044 1112 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000036113
SMART Domains Protein: ENSMUSP00000048516
Gene: ENSMUSG00000039976

DomainStartEndE-ValueType
low complexity region 17 30 N/A INTRINSIC
Blast:TBC 63 362 5e-75 BLAST
Blast:TBC 373 418 2e-13 BLAST
TBC 421 659 4.39e-43 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000053440
AA Change: Y249H

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000062198
Gene: ENSMUSG00000039963
AA Change: Y249H

DomainStartEndE-ValueType
low complexity region 5 27 N/A INTRINSIC
low complexity region 56 70 N/A INTRINSIC
internal_repeat_1 79 114 5.57e-8 PROSPERO
internal_repeat_1 111 150 5.57e-8 PROSPERO
low complexity region 229 240 N/A INTRINSIC
low complexity region 278 302 N/A INTRINSIC
coiled coil region 419 441 N/A INTRINSIC
coiled coil region 493 517 N/A INTRINSIC
Blast:HisKA 520 589 2e-13 BLAST
Blast:HisKA 644 699 4e-8 BLAST
low complexity region 863 875 N/A INTRINSIC
Pfam:BRE1 900 998 4e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147037
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150358
Predicted Effect probably benign
Transcript: ENSMUST00000207655
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 97% (99/102)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is necessary for motile cilia function. It functions in correct left-right axis formation by regulating the assembly of the inner dynein arm and the dynein regulatory complexes, which control ciliary beat. Mutations in this gene cause ciliary dyskinesia type 15, a disorder due to defects in cilia motility. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit heterotaxia, hydrocephalus, short embryonic cilia, and postnatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427G23Rik A T 5: 24,036,048 (GRCm39) noncoding transcript Het
Acox2 A G 14: 8,243,835 (GRCm38) probably benign Het
Adgb T C 10: 10,306,811 (GRCm39) probably null Het
Adgra3 C A 5: 50,119,099 (GRCm39) probably benign Het
Adgre4 G A 17: 56,159,288 (GRCm39) V658I probably benign Het
Ahnak A G 19: 8,990,235 (GRCm39) probably benign Het
Anapc2 A G 2: 25,168,337 (GRCm39) T159A probably damaging Het
Arfgef3 A G 10: 18,488,875 (GRCm39) probably benign Het
Atf7ip C T 6: 136,537,010 (GRCm39) S81L possibly damaging Het
Cacna1i A G 15: 80,253,031 (GRCm39) probably benign Het
Camk1 A T 6: 113,318,852 (GRCm39) Y20* probably null Het
Cd109 T A 9: 78,619,897 (GRCm39) S1380T probably benign Het
Cfap57 A T 4: 118,426,628 (GRCm39) L1107Q possibly damaging Het
Col6a4 C T 9: 105,952,279 (GRCm39) V540I probably damaging Het
Cst9 T A 2: 148,680,362 (GRCm39) probably benign Het
Cul5 C T 9: 53,578,370 (GRCm39) V73I probably benign Het
Cxcl16 T A 11: 70,349,574 (GRCm39) K84* probably null Het
Cyp2c29 T C 19: 39,317,539 (GRCm39) probably benign Het
D6Ertd527e C G 6: 87,088,506 (GRCm39) T223S unknown Het
Dip2c C T 13: 9,618,325 (GRCm39) probably benign Het
Dis3 A T 14: 99,324,892 (GRCm39) I513N probably damaging Het
Dnajc16 A T 4: 141,516,359 (GRCm39) L3* probably null Het
Dop1a T A 9: 86,388,555 (GRCm39) L480M probably damaging Het
Eml6 A G 11: 29,699,392 (GRCm39) V1787A possibly damaging Het
Etnk1 A G 6: 143,126,500 (GRCm39) N115S probably damaging Het
Fryl T C 5: 73,255,757 (GRCm39) Y758C probably damaging Het
Gbp4 G A 5: 105,268,972 (GRCm39) R394C possibly damaging Het
Ggnbp2 A C 11: 84,724,051 (GRCm39) probably benign Het
Gm7137 A G 10: 77,624,007 (GRCm39) probably benign Het
Gstm2 T A 3: 107,891,322 (GRCm39) Q132L probably benign Het
Habp2 T C 19: 56,306,149 (GRCm39) probably benign Het
Hectd2 T C 19: 36,562,284 (GRCm39) probably benign Het
Htr6 A G 4: 138,789,392 (GRCm39) I291T possibly damaging Het
Ighg2c T C 12: 113,251,530 (GRCm39) D199G unknown Het
Itih2 A G 2: 10,110,426 (GRCm39) probably benign Het
Kcnab2 A G 4: 152,479,593 (GRCm39) F248S probably benign Het
Kcnc4 T C 3: 107,352,749 (GRCm39) K610E probably damaging Het
Kcnk16 T A 14: 20,313,043 (GRCm39) probably null Het
Kndc1 C T 7: 139,510,037 (GRCm39) T1293I probably damaging Het
Lcp1 A T 14: 75,464,446 (GRCm39) I556F possibly damaging Het
Lrrc8d T C 5: 105,959,731 (GRCm39) L47P probably damaging Het
Lyset T A 12: 102,711,135 (GRCm39) Y119* probably null Het
Lyst T C 13: 13,886,195 (GRCm39) probably benign Het
Macrod2 G A 2: 142,052,065 (GRCm39) probably null Het
Mical2 C T 7: 111,980,235 (GRCm39) R70C probably damaging Het
Mllt3 ACTGCTGCTGCTGCTGCTGCT ACTGCTGCTGCTGCTGCT 4: 87,759,576 (GRCm39) probably benign Het
Msh3 A G 13: 92,483,294 (GRCm39) V283A possibly damaging Het
Nup205 T C 6: 35,191,569 (GRCm39) probably benign Het
Nxpe2 T C 9: 48,237,914 (GRCm39) T114A probably damaging Het
Or51e2 C T 7: 102,391,294 (GRCm39) M305I probably benign Het
Or5m10 A T 2: 85,717,782 (GRCm39) I213F possibly damaging Het
Or5m9 A T 2: 85,877,399 (GRCm39) H191L probably benign Het
Or8c15 A T 9: 38,121,269 (GRCm39) M305L probably benign Het
Or8g2 A G 9: 39,821,279 (GRCm39) Y60C probably damaging Het
Pard3 G A 8: 128,337,047 (GRCm39) G1221D probably damaging Het
Pax5 G A 4: 44,691,886 (GRCm39) A120V probably damaging Het
Pcsk6 C T 7: 65,683,622 (GRCm39) R746C probably damaging Het
Pif1 G A 9: 65,495,333 (GRCm39) C81Y probably benign Het
Plcb1 A G 2: 135,179,419 (GRCm39) Y609C probably damaging Het
Plcd4 C A 1: 74,591,256 (GRCm39) S217Y probably damaging Het
Plxna1 G A 6: 89,334,318 (GRCm39) H104Y probably benign Het
Polr2k A G 15: 36,175,602 (GRCm39) Y45C probably damaging Het
Prex1 A G 2: 166,428,619 (GRCm39) probably benign Het
Pth2r A G 1: 65,427,598 (GRCm39) M424V probably benign Het
Pygm A G 19: 6,441,396 (GRCm39) R464G probably benign Het
Rad51c A G 11: 87,288,481 (GRCm39) L234P probably damaging Het
Rnf145 A G 11: 44,415,965 (GRCm39) Y60C probably damaging Het
Rnf167 T C 11: 70,540,525 (GRCm39) I135T probably damaging Het
Rnf213 A T 11: 119,305,295 (GRCm39) I509F probably damaging Het
Ro60 G T 1: 143,635,813 (GRCm39) N444K probably benign Het
Ryr2 T C 13: 11,884,042 (GRCm39) S213G probably damaging Het
Selenbp1 T C 3: 94,844,224 (GRCm39) V27A possibly damaging Het
Selenof T G 3: 144,283,453 (GRCm39) L14R probably damaging Het
Sfswap A T 5: 129,581,190 (GRCm39) D121V probably damaging Het
Slc25a34 C A 4: 141,347,780 (GRCm39) M300I possibly damaging Het
Slc34a3 T G 2: 25,119,122 (GRCm39) T583P probably benign Het
Slc66a3 C A 12: 17,047,711 (GRCm39) probably benign Het
Smg1 C A 7: 117,781,691 (GRCm39) A1199S probably benign Het
Spint1 A G 2: 119,076,096 (GRCm39) T231A probably damaging Het
Sptbn1 A C 11: 30,099,576 (GRCm39) N229K probably damaging Het
Sult2b1 A G 7: 45,379,516 (GRCm39) probably benign Het
Tas2r123 A T 6: 132,824,801 (GRCm39) M233L probably damaging Het
Tbcel C A 9: 42,355,796 (GRCm39) C139F probably benign Het
Thbs2 A C 17: 14,900,235 (GRCm39) S573A probably benign Het
Tmem132c A G 5: 127,640,769 (GRCm39) E980G probably damaging Het
Tmem247 G T 17: 87,229,750 (GRCm39) C197F probably damaging Het
Tmem43 C A 6: 91,459,300 (GRCm39) P257Q probably benign Het
Tmprss13 A G 9: 45,248,430 (GRCm39) probably null Het
Ubr5 T C 15: 37,973,224 (GRCm39) T2626A probably damaging Het
Vmn1r196 T A 13: 22,478,006 (GRCm39) V215D probably damaging Het
Vmn1r22 G T 6: 57,877,317 (GRCm39) T220K probably benign Het
Vmn2r116 G A 17: 23,606,253 (GRCm39) M388I possibly damaging Het
Vmn2r74 A C 7: 85,610,618 (GRCm39) C25G probably damaging Het
Xndc1 T C 7: 101,729,823 (GRCm39) probably benign Het
Zfp282 A G 6: 47,874,815 (GRCm39) D340G probably damaging Het
Zfp282 T A 6: 47,881,987 (GRCm39) I558N possibly damaging Het
Zfp316 T A 5: 143,250,246 (GRCm39) T56S unknown Het
Zfp345 A G 2: 150,316,479 (GRCm39) probably benign Het
Other mutations in Ccdc40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01538:Ccdc40 APN 11 119,133,545 (GRCm39) missense possibly damaging 0.90
IGL01864:Ccdc40 APN 11 119,133,911 (GRCm39) missense probably benign 0.23
IGL01911:Ccdc40 APN 11 119,122,797 (GRCm39) splice site probably null
IGL02640:Ccdc40 APN 11 119,128,904 (GRCm39) missense probably benign 0.18
IGL03278:Ccdc40 APN 11 119,133,336 (GRCm39) missense probably damaging 1.00
IGL03054:Ccdc40 UTSW 11 119,154,027 (GRCm39) missense possibly damaging 0.69
PIT4151001:Ccdc40 UTSW 11 119,133,277 (GRCm39) missense probably damaging 1.00
R0139:Ccdc40 UTSW 11 119,155,125 (GRCm39) missense probably benign 0.00
R0140:Ccdc40 UTSW 11 119,155,125 (GRCm39) missense probably benign 0.00
R0617:Ccdc40 UTSW 11 119,133,630 (GRCm39) missense probably damaging 1.00
R1396:Ccdc40 UTSW 11 119,122,629 (GRCm39) missense possibly damaging 0.66
R1531:Ccdc40 UTSW 11 119,154,015 (GRCm39) missense probably benign 0.01
R1751:Ccdc40 UTSW 11 119,121,522 (GRCm39) critical splice donor site probably null
R1767:Ccdc40 UTSW 11 119,121,522 (GRCm39) critical splice donor site probably null
R1870:Ccdc40 UTSW 11 119,150,730 (GRCm39) missense possibly damaging 0.81
R1971:Ccdc40 UTSW 11 119,153,901 (GRCm39) splice site probably null
R2106:Ccdc40 UTSW 11 119,155,123 (GRCm39) missense probably damaging 1.00
R2370:Ccdc40 UTSW 11 119,153,943 (GRCm39) missense probably benign 0.00
R3421:Ccdc40 UTSW 11 119,125,605 (GRCm39) missense probably benign 0.02
R3746:Ccdc40 UTSW 11 119,155,252 (GRCm39) missense probably benign 0.26
R3749:Ccdc40 UTSW 11 119,155,252 (GRCm39) missense probably benign 0.26
R3871:Ccdc40 UTSW 11 119,155,107 (GRCm39) missense probably damaging 1.00
R4508:Ccdc40 UTSW 11 119,133,335 (GRCm39) missense probably damaging 0.98
R4613:Ccdc40 UTSW 11 119,122,358 (GRCm39) missense probably benign 0.09
R4663:Ccdc40 UTSW 11 119,122,332 (GRCm39) missense probably benign 0.01
R4787:Ccdc40 UTSW 11 119,144,447 (GRCm39) missense possibly damaging 0.74
R4867:Ccdc40 UTSW 11 119,122,614 (GRCm39) missense probably benign
R5237:Ccdc40 UTSW 11 119,150,802 (GRCm39) missense probably benign 0.00
R5661:Ccdc40 UTSW 11 119,128,753 (GRCm39) missense probably benign 0.13
R5678:Ccdc40 UTSW 11 119,122,398 (GRCm39) missense possibly damaging 0.61
R5805:Ccdc40 UTSW 11 119,136,906 (GRCm39) critical splice donor site probably null
R5830:Ccdc40 UTSW 11 119,133,572 (GRCm39) missense probably benign 0.00
R5895:Ccdc40 UTSW 11 119,144,229 (GRCm39) missense probably damaging 1.00
R5932:Ccdc40 UTSW 11 119,141,838 (GRCm39) missense probably damaging 0.98
R6034:Ccdc40 UTSW 11 119,133,898 (GRCm39) missense possibly damaging 0.70
R6034:Ccdc40 UTSW 11 119,133,898 (GRCm39) missense possibly damaging 0.70
R6109:Ccdc40 UTSW 11 119,122,804 (GRCm39) missense probably benign
R6166:Ccdc40 UTSW 11 119,122,827 (GRCm39) missense probably benign
R6336:Ccdc40 UTSW 11 119,122,819 (GRCm39) missense possibly damaging 0.82
R6569:Ccdc40 UTSW 11 119,133,560 (GRCm39) missense probably damaging 1.00
R6884:Ccdc40 UTSW 11 119,133,565 (GRCm39) missense possibly damaging 0.82
R7022:Ccdc40 UTSW 11 119,122,612 (GRCm39) missense possibly damaging 0.82
R7212:Ccdc40 UTSW 11 119,155,270 (GRCm39) missense probably damaging 0.99
R7472:Ccdc40 UTSW 11 119,153,974 (GRCm39) missense probably benign 0.30
R7522:Ccdc40 UTSW 11 119,123,047 (GRCm39) missense possibly damaging 0.73
R7888:Ccdc40 UTSW 11 119,119,967 (GRCm39) missense unknown
R8041:Ccdc40 UTSW 11 119,122,507 (GRCm39) missense possibly damaging 0.53
R8117:Ccdc40 UTSW 11 119,144,211 (GRCm39) missense probably benign 0.00
R8162:Ccdc40 UTSW 11 119,150,870 (GRCm39) critical splice donor site probably null
R8514:Ccdc40 UTSW 11 119,121,459 (GRCm39) missense unknown
R8725:Ccdc40 UTSW 11 119,155,323 (GRCm39) missense probably benign
R8727:Ccdc40 UTSW 11 119,155,323 (GRCm39) missense probably benign
R8799:Ccdc40 UTSW 11 119,155,292 (GRCm39) missense probably benign 0.00
R8877:Ccdc40 UTSW 11 119,153,992 (GRCm39) missense probably damaging 1.00
R9304:Ccdc40 UTSW 11 119,122,597 (GRCm39) missense probably benign 0.06
S24628:Ccdc40 UTSW 11 119,122,944 (GRCm39) missense possibly damaging 0.92
Z1176:Ccdc40 UTSW 11 119,142,834 (GRCm39) missense probably damaging 1.00
Z1177:Ccdc40 UTSW 11 119,145,224 (GRCm39) missense probably benign 0.16
Z1177:Ccdc40 UTSW 11 119,128,933 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGACGTGGACTCCATTAGGAAGGC -3'
(R):5'- AAACACTCACCGTGCTGTCCTC -3'

Sequencing Primer
(F):5'- CCTCCGAGGAATAGACTTGGAATC -3'
(R):5'- GGCTCATATATGCCTTGCTGGA -3'
Posted On 2013-05-23