Incidental Mutation 'R5329:Cgn'
ID422205
Institutional Source Beutler Lab
Gene Symbol Cgn
Ensembl Gene ENSMUSG00000068876
Gene Namecingulin
Synonyms6330408J11Rik
MMRRC Submission 042911-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5329 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location94760069-94786492 bp(-) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) T to C at 94779990 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 1 (M1V)
Ref Sequence ENSEMBL: ENSMUSP00000102893 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107272] [ENSMUST00000107273] [ENSMUST00000153263] [ENSMUST00000155485]
Predicted Effect probably null
Transcript: ENSMUST00000107272
AA Change: M1V

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000102893
Gene: ENSMUSG00000068876
AA Change: M1V

DomainStartEndE-ValueType
low complexity region 31 43 N/A INTRINSIC
low complexity region 189 198 N/A INTRINSIC
internal_repeat_1 214 229 8.06e-5 PROSPERO
low complexity region 242 260 N/A INTRINSIC
internal_repeat_1 287 302 8.06e-5 PROSPERO
low complexity region 446 462 N/A INTRINSIC
low complexity region 466 481 N/A INTRINSIC
low complexity region 536 549 N/A INTRINSIC
low complexity region 567 592 N/A INTRINSIC
low complexity region 660 676 N/A INTRINSIC
low complexity region 758 775 N/A INTRINSIC
Pfam:Myosin_tail_1 783 1140 3.4e-31 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000107273
AA Change: M1V

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000102894
Gene: ENSMUSG00000068876
AA Change: M1V

DomainStartEndE-ValueType
low complexity region 31 43 N/A INTRINSIC
low complexity region 189 198 N/A INTRINSIC
internal_repeat_1 214 229 8.83e-5 PROSPERO
low complexity region 242 260 N/A INTRINSIC
internal_repeat_1 287 302 8.83e-5 PROSPERO
low complexity region 454 470 N/A INTRINSIC
low complexity region 474 489 N/A INTRINSIC
low complexity region 544 557 N/A INTRINSIC
low complexity region 575 600 N/A INTRINSIC
low complexity region 668 684 N/A INTRINSIC
low complexity region 766 783 N/A INTRINSIC
Pfam:Myosin_tail_1 799 1144 2.2e-37 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000153263
AA Change: M1V

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000143156
Gene: ENSMUSG00000068876
AA Change: M1V

DomainStartEndE-ValueType
low complexity region 31 43 N/A INTRINSIC
low complexity region 189 198 N/A INTRINSIC
low complexity region 242 260 N/A INTRINSIC
coiled coil region 337 402 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000155485
AA Change: M1V

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000142809
Gene: ENSMUSG00000068876
AA Change: M1V

DomainStartEndE-ValueType
low complexity region 31 43 N/A INTRINSIC
low complexity region 189 198 N/A INTRINSIC
low complexity region 242 260 N/A INTRINSIC
low complexity region 340 357 N/A INTRINSIC
coiled coil region 381 447 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (61/62)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased sensitivity to the ulcerogenic action of cysteamine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430005L14Rik G A 4: 153,959,827 V32I probably benign Het
Abcg4 A T 9: 44,279,545 M19K probably benign Het
Acsm1 A G 7: 119,656,051 T392A probably benign Het
Adam19 A T 11: 46,125,026 I338F probably damaging Het
Adamdec1 C T 14: 68,570,163 M349I probably damaging Het
Arhgef11 T A 3: 87,679,752 probably benign Het
Bptf T C 11: 107,073,295 D1628G probably benign Het
Camk2d C T 3: 126,597,482 Q15* probably null Het
Camk2g T G 14: 20,793,931 D12A possibly damaging Het
Clec16a G A 16: 10,731,679 C872Y probably damaging Het
Dcbld1 C A 10: 52,284,257 probably benign Het
Ear-ps2 G A 14: 44,047,060 noncoding transcript Het
Espl1 T A 15: 102,312,518 L903Q probably damaging Het
Gm11639 T G 11: 104,753,806 probably null Het
Gm5117 T A 8: 31,737,882 noncoding transcript Het
Gm5150 T C 3: 15,963,424 T228A probably benign Het
Gm5435 A T 12: 82,496,476 noncoding transcript Het
Gpr156 T A 16: 38,005,448 C676S probably benign Het
Gstt3 C T 10: 75,774,851 E230K possibly damaging Het
Jarid2 A G 13: 44,906,271 I660V possibly damaging Het
Kif13a A G 13: 46,775,401 probably null Het
Kntc1 T A 5: 123,764,191 V299D probably benign Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Lipk T A 19: 34,020,213 probably null Het
Loxhd1 T C 18: 77,332,682 L334P probably damaging Het
Macc1 T A 12: 119,446,477 Y327N probably damaging Het
Man2a2 G A 7: 80,361,128 S705L possibly damaging Het
Mmp1b T C 9: 7,384,897 I251V possibly damaging Het
Ncam2 A T 16: 81,434,819 Q57L probably damaging Het
Nedd1 T C 10: 92,686,240 E645G probably damaging Het
Nfatc1 A T 18: 80,708,117 M1K probably null Het
Nlrp9b A T 7: 20,023,991 R384S probably damaging Het
Nrxn3 A G 12: 89,813,584 H62R possibly damaging Het
Olfr1097 A G 2: 86,890,620 L185S probably damaging Het
Olfr1233 T A 2: 89,339,459 Y281F probably damaging Het
Olfr640 T C 7: 104,021,997 H107R probably damaging Het
Olfr753-ps1 T A 17: 37,170,000 Y216F probably damaging Het
Olfr887 A T 9: 38,085,126 M97L probably benign Het
Pdzph1 T A 17: 58,974,880 I136F probably damaging Het
Pigg T C 5: 108,314,160 I119T probably damaging Het
R3hdm2 A G 10: 127,458,893 H215R probably damaging Het
Sept14 C T 5: 129,685,914 probably null Het
Slc9a3 T C 13: 74,150,960 M166T possibly damaging Het
Spock3 A G 8: 63,345,782 D279G probably damaging Het
Suco T C 1: 161,833,430 I967V probably damaging Het
Tgtp1 A G 11: 48,987,176 L234P probably damaging Het
Tmem176a A G 6: 48,842,217 D4G probably benign Het
Tmem2 T C 19: 21,798,329 I312T probably benign Het
Ugt1a10 G A 1: 88,216,254 A199T probably damaging Het
Uox A G 3: 146,624,545 D152G probably damaging Het
Vmn1r35 C T 6: 66,679,506 W60* probably null Het
Vmn2r103 T C 17: 19,812,171 C736R probably damaging Het
Other mutations in Cgn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Cgn APN 3 94765548 missense probably benign 0.00
IGL00823:Cgn APN 3 94767209 missense probably damaging 1.00
IGL01349:Cgn APN 3 94767176 nonsense probably null
IGL01433:Cgn APN 3 94779459 missense probably damaging 0.99
IGL01467:Cgn APN 3 94779588 missense probably damaging 1.00
IGL01781:Cgn APN 3 94773205 missense probably benign
IGL01789:Cgn APN 3 94776218 missense possibly damaging 0.63
IGL01879:Cgn APN 3 94774364 nonsense probably null
IGL02805:Cgn APN 3 94774377 missense probably damaging 0.96
IGL02814:Cgn APN 3 94774240 missense probably benign 0.00
IGL02926:Cgn APN 3 94778016 missense probably benign 0.01
IGL03113:Cgn APN 3 94779234 missense probably benign
IGL03340:Cgn APN 3 94778095 intron probably benign
R0054:Cgn UTSW 3 94762592 missense possibly damaging 0.95
R0310:Cgn UTSW 3 94765653 missense possibly damaging 0.88
R0355:Cgn UTSW 3 94774932 missense probably benign
R0615:Cgn UTSW 3 94770714 unclassified probably benign
R0656:Cgn UTSW 3 94774894 unclassified probably benign
R1491:Cgn UTSW 3 94763228 missense probably damaging 1.00
R1509:Cgn UTSW 3 94774258 missense probably benign 0.00
R1794:Cgn UTSW 3 94762557 critical splice donor site probably null
R2113:Cgn UTSW 3 94779806 missense probably damaging 1.00
R3121:Cgn UTSW 3 94778482 splice site probably benign
R4655:Cgn UTSW 3 94779249 nonsense probably null
R4703:Cgn UTSW 3 94776095 utr 3 prime probably benign
R4714:Cgn UTSW 3 94779438 missense probably damaging 1.00
R4715:Cgn UTSW 3 94779438 missense probably damaging 1.00
R4959:Cgn UTSW 3 94778254 missense probably benign 0.06
R4973:Cgn UTSW 3 94778254 missense probably benign 0.06
R4995:Cgn UTSW 3 94779936 missense probably damaging 1.00
R5011:Cgn UTSW 3 94776145 missense probably null 1.00
R5524:Cgn UTSW 3 94779989 start codon destroyed probably null 0.56
R5695:Cgn UTSW 3 94773635 missense probably benign 0.00
R5839:Cgn UTSW 3 94774393 missense probably damaging 0.99
R5987:Cgn UTSW 3 94779522 missense probably benign 0.00
R6146:Cgn UTSW 3 94767125 missense possibly damaging 0.94
R6311:Cgn UTSW 3 94778176 intron probably benign
R6948:Cgn UTSW 3 94773221 missense probably benign 0.06
R7038:Cgn UTSW 3 94763085 missense possibly damaging 0.80
R7231:Cgn UTSW 3 94773192 missense probably damaging 0.99
R7251:Cgn UTSW 3 94776199 missense possibly damaging 0.82
R7408:Cgn UTSW 3 94763055 nonsense probably null
R7828:Cgn UTSW 3 94769179 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TCTCTCCACTGTTAAGAACCAC -3'
(R):5'- GGTGTGGGCCTCAAAGTATG -3'

Sequencing Primer
(F):5'- TCCACTGTTAAGAACCACAAACGG -3'
(R):5'- TTGTACACACTAGGCAAGCTGTC -3'
Posted On2016-08-04