Incidental Mutation 'R5502:Mycbp2'
ID430697
Institutional Source Beutler Lab
Gene Symbol Mycbp2
Ensembl Gene ENSMUSG00000033004
Gene NameMYC binding protein 2
SynonymsC130061D10Rik, Phr1, Pam
MMRRC Submission 043063-MU
Accession Numbers

Genbank: NM_207215; MGI: 2179432

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5502 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location103113411-103346814 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 103173814 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 284 (G284R)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159855] [ENSMUST00000160758]
Predicted Effect probably damaging
Transcript: ENSMUST00000159855
AA Change: G2684R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124710
Gene: ENSMUSG00000033004
AA Change: G2684R

DomainStartEndE-ValueType
low complexity region 5 27 N/A INTRINSIC
low complexity region 47 55 N/A INTRINSIC
low complexity region 100 127 N/A INTRINSIC
low complexity region 178 191 N/A INTRINSIC
Pfam:RCC1_2 683 712 1.4e-10 PFAM
low complexity region 737 750 N/A INTRINSIC
low complexity region 793 815 N/A INTRINSIC
Pfam:RCC1_2 942 971 5.5e-10 PFAM
Pfam:RCC1 958 1006 4.8e-15 PFAM
Pfam:PHR 1235 1385 8.2e-44 PFAM
Pfam:PHR 1723 1880 1.4e-43 PFAM
low complexity region 1935 1948 N/A INTRINSIC
low complexity region 2182 2195 N/A INTRINSIC
Pfam:Filamin 2261 2431 7.5e-9 PFAM
Pfam:SH3_3 2472 2539 4.1e-9 PFAM
internal_repeat_3 2612 2679 1.69e-7 PROSPERO
low complexity region 2701 2710 N/A INTRINSIC
low complexity region 2884 2917 N/A INTRINSIC
low complexity region 2970 2984 N/A INTRINSIC
coiled coil region 3263 3290 N/A INTRINSIC
low complexity region 3352 3365 N/A INTRINSIC
low complexity region 3418 3433 N/A INTRINSIC
low complexity region 3678 3695 N/A INTRINSIC
APC10 3810 3968 1.11e-18 SMART
low complexity region 4103 4115 N/A INTRINSIC
low complexity region 4190 4212 N/A INTRINSIC
Blast:BBOX 4327 4370 7e-7 BLAST
RING 4496 4546 5.35e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000160758
AA Change: G2626R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124601
Gene: ENSMUSG00000033004
AA Change: G2626R

DomainStartEndE-ValueType
low complexity region 14 22 N/A INTRINSIC
low complexity region 67 94 N/A INTRINSIC
low complexity region 145 158 N/A INTRINSIC
Pfam:RCC1_2 650 679 1e-10 PFAM
low complexity region 704 717 N/A INTRINSIC
low complexity region 760 782 N/A INTRINSIC
Pfam:RCC1_2 909 938 1.5e-9 PFAM
Pfam:RCC1 925 973 1.3e-15 PFAM
Pfam:PHR 1202 1353 1.6e-50 PFAM
Pfam:PHR 1690 1848 3.1e-58 PFAM
low complexity region 1902 1915 N/A INTRINSIC
low complexity region 2149 2162 N/A INTRINSIC
Pfam:Filamin 2228 2398 7.6e-9 PFAM
Pfam:SH3_3 2439 2507 2.3e-10 PFAM
internal_repeat_3 2554 2621 2e-7 PROSPERO
low complexity region 2643 2652 N/A INTRINSIC
low complexity region 2774 2807 N/A INTRINSIC
low complexity region 2860 2874 N/A INTRINSIC
coiled coil region 3153 3180 N/A INTRINSIC
low complexity region 3242 3255 N/A INTRINSIC
low complexity region 3308 3323 N/A INTRINSIC
low complexity region 3568 3585 N/A INTRINSIC
APC10 3700 3858 1.11e-18 SMART
low complexity region 3993 4005 N/A INTRINSIC
low complexity region 4080 4102 N/A INTRINSIC
Blast:BBOX 4217 4260 7e-7 BLAST
RING 4386 4436 5.35e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000161278
AA Change: G284R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125189
Gene: ENSMUSG00000033004
AA Change: G284R

DomainStartEndE-ValueType
Blast:IG_FLMN 2 66 1e-37 BLAST
SCOP:d1qfha1 14 64 2e-7 SMART
Pfam:SH3_3 98 165 5.8e-10 PFAM
internal_repeat_1 213 280 8.77e-8 PROSPERO
low complexity region 302 311 N/A INTRINSIC
low complexity region 485 518 N/A INTRINSIC
low complexity region 571 585 N/A INTRINSIC
Meta Mutation Damage Score 0.2093 question?
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.3%
  • 10x: 95.0%
  • 20x: 90.2%
Validation Efficiency 98% (84/86)
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted allele exhibit neonatal lethality, defective diaphragm innervation, abnormal brain morphology and defective axonal guidance. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(5) Chemically induced(3)

Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Abcc8 A G 7: 46,108,838 I1268T probably benign Het
Accsl C T 2: 93,856,944 probably null Het
Ank3 A T 10: 69,920,461 I842F probably benign Het
Bbs9 T A 9: 22,504,074 L98Q probably damaging Het
BC017158 C T 7: 128,285,136 V225M probably damaging Het
BC024978 A G 7: 27,197,117 D35G possibly damaging Het
Bin2 A G 15: 100,645,405 V299A probably benign Het
Cabp4 G A 19: 4,131,229 probably benign Het
Ces2f A T 8: 104,952,523 H324L possibly damaging Het
Chd4 G A 6: 125,105,276 R576Q possibly damaging Het
Cndp1 A G 18: 84,632,013 V185A possibly damaging Het
Cntn3 A C 6: 102,265,334 V450G possibly damaging Het
Col5a2 C A 1: 45,380,126 G1265W probably damaging Het
Corin G A 5: 72,316,106 Q754* probably null Het
Cyp4a10 A G 4: 115,525,505 N291S probably benign Het
Dap3 T C 3: 88,925,326 Y353C probably damaging Het
Disp1 A G 1: 183,087,886 V990A probably damaging Het
Dock9 A T 14: 121,610,182 probably null Het
Dopey2 T A 16: 93,793,226 V179E probably benign Het
Eps15l1 A T 8: 72,378,992 probably null Het
Fyb2 A T 4: 104,945,324 Q141L probably damaging Het
Gemin4 A T 11: 76,213,401 L178* probably null Het
Gm15446 A T 5: 109,940,498 K25* probably null Het
Gm17067 A T 7: 42,708,419 C220S probably damaging Het
Gm4868 A G 5: 125,847,978 noncoding transcript Het
Golga4 GT GTT 9: 118,559,057 probably null Het
Gria2 T C 3: 80,706,945 N596S probably damaging Het
Hoxb4 A G 11: 96,320,231 D219G probably damaging Het
Htr1b T A 9: 81,631,801 Q251L possibly damaging Het
Ibtk A C 9: 85,720,863 S696R probably benign Het
Ide C A 19: 37,330,456 K52N unknown Het
Incenp C A 19: 9,893,364 L300F unknown Het
Ino80 T C 2: 119,402,396 Y1147C probably damaging Het
Mme T A 3: 63,300,281 Y49* probably null Het
Mmp15 A T 8: 95,368,184 T229S possibly damaging Het
Mtmr4 A T 11: 87,614,078 N1133I probably damaging Het
Myo3a T C 2: 22,558,369 I52T probably damaging Het
Nat8f5 G T 6: 85,817,653 F108L probably damaging Het
Nbeal1 T A 1: 60,310,999 H2402Q probably damaging Het
Nexn T A 3: 152,238,304 E331D probably damaging Het
Nktr C T 9: 121,748,606 probably benign Het
Oaz3 T C 3: 94,435,085 D88G probably damaging Het
Olfr351 T C 2: 36,860,270 Y26C probably damaging Het
Olfr723 A G 14: 49,929,536 Y3H probably benign Het
Pcdhb9 A T 18: 37,401,603 T217S possibly damaging Het
Pcdhga2 A T 18: 37,670,552 D483V possibly damaging Het
Pde5a G T 3: 122,803,032 G456V probably damaging Het
Qser1 T C 2: 104,786,574 T1298A probably benign Het
Rapgef5 T C 12: 117,721,329 V303A probably damaging Het
Rbbp6 T G 7: 122,988,724 M267R probably damaging Het
Rfx8 C A 1: 39,682,953 V291F probably damaging Het
Rnf121 T C 7: 102,023,348 K276R probably null Het
Rtca G T 3: 116,489,282 Y352* probably null Het
Sacs T C 14: 61,206,100 V1865A probably damaging Het
Sclt1 C T 3: 41,657,275 E521K probably benign Het
Setd1a T C 7: 127,797,248 probably null Het
Slc37a4 G T 9: 44,402,097 V337L probably benign Het
Slc5a9 G T 4: 111,893,169 S79* probably null Het
Snrpd2 T C 7: 19,151,322 V36A probably benign Het
Spata31d1b A T 13: 59,716,672 N545Y probably damaging Het
Sstr4 CGAGGAGGAGGAGGA CGAGGAGGAGGAGGAGGA 2: 148,395,551 probably benign Het
St7 G A 6: 17,834,674 V98I possibly damaging Het
Strip2 A T 6: 29,927,624 I223F probably benign Het
Syn2 A C 6: 115,278,352 N542H possibly damaging Het
Tbc1d2b T C 9: 90,227,443 T327A probably benign Het
Timm44 A T 8: 4,269,992 F59I possibly damaging Het
Tmem41b A T 7: 109,982,763 C44* probably null Het
Tob1 ACAGCAGCAGCAGCAGCAGCAGCAGCA ACAGCAGCAGCAGCAGCAGCAGCA 11: 94,214,452 probably benign Het
Tusc3 A T 8: 39,130,793 K188* probably null Het
Usp39 T A 6: 72,328,687 Q371L probably benign Het
Vmn2r13 G T 5: 109,173,714 N372K probably damaging Het
Zfp961 T A 8: 71,968,059 Y139N probably damaging Het
Other mutations in Mycbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Mycbp2 APN 14 103223050 missense probably damaging 1.00
IGL00518:Mycbp2 APN 14 103155808 missense probably damaging 1.00
IGL00650:Mycbp2 APN 14 103143228 missense probably damaging 0.97
IGL00653:Mycbp2 APN 14 103143228 missense probably damaging 0.97
IGL00742:Mycbp2 APN 14 103201352 missense probably damaging 1.00
IGL00755:Mycbp2 APN 14 103194621 missense possibly damaging 0.72
IGL00793:Mycbp2 APN 14 103126753 missense possibly damaging 0.77
IGL00916:Mycbp2 APN 14 103291283 splice site probably benign
IGL00960:Mycbp2 APN 14 103229384 missense possibly damaging 0.95
IGL00977:Mycbp2 APN 14 103172642 missense probably damaging 0.98
IGL01349:Mycbp2 APN 14 103122547 missense probably damaging 0.98
IGL01369:Mycbp2 APN 14 103155510 missense possibly damaging 0.61
IGL01410:Mycbp2 APN 14 103229492 splice site probably null
IGL01586:Mycbp2 APN 14 103140869 critical splice donor site probably null
IGL01593:Mycbp2 APN 14 103291287 critical splice donor site probably null
IGL01693:Mycbp2 APN 14 103127979 missense probably damaging 0.99
IGL01730:Mycbp2 APN 14 103135204 nonsense probably null
IGL01820:Mycbp2 APN 14 103188501 missense probably damaging 1.00
IGL01974:Mycbp2 APN 14 103143211 missense possibly damaging 0.88
IGL02071:Mycbp2 APN 14 103154907 nonsense probably null
IGL02178:Mycbp2 APN 14 103224366 missense probably benign 0.01
IGL02324:Mycbp2 APN 14 103242207 missense probably damaging 1.00
IGL02442:Mycbp2 APN 14 103314375 missense probably benign
IGL02607:Mycbp2 APN 14 103285273 missense probably damaging 1.00
IGL02679:Mycbp2 APN 14 103205185 missense probably benign
IGL02702:Mycbp2 APN 14 103220124 missense probably benign 0.01
IGL02709:Mycbp2 APN 14 103155261 missense probably damaging 0.97
IGL02736:Mycbp2 APN 14 103114242 splice site probably benign
IGL02866:Mycbp2 APN 14 103129992 missense probably damaging 0.98
IGL02939:Mycbp2 APN 14 103177279 missense probably benign
IGL03082:Mycbp2 APN 14 103204369 missense probably benign 0.23
IGL03142:Mycbp2 APN 14 103298776 missense probably damaging 0.99
IGL03155:Mycbp2 APN 14 103155453 missense probably benign 0.06
IGL03236:Mycbp2 APN 14 103298698 missense probably damaging 0.99
IGL03256:Mycbp2 APN 14 103188589 missense possibly damaging 0.92
IGL03303:Mycbp2 APN 14 103247758 missense probably damaging 1.00
decompose UTSW 14 103219979 missense probably benign 0.12
moulder UTSW 14 103188592 missense probably damaging 1.00
N/A - 293:Mycbp2 UTSW 14 103224462 splice site probably benign
R0040:Mycbp2 UTSW 14 103224272 missense probably benign 0.11
R0040:Mycbp2 UTSW 14 103224272 missense probably benign 0.11
R0057:Mycbp2 UTSW 14 103152142 missense probably damaging 0.97
R0063:Mycbp2 UTSW 14 103156634 unclassified probably benign
R0097:Mycbp2 UTSW 14 103155762 missense probably damaging 1.00
R0097:Mycbp2 UTSW 14 103155762 missense probably damaging 1.00
R0268:Mycbp2 UTSW 14 103314325 nonsense probably null
R0388:Mycbp2 UTSW 14 103156667 missense probably benign 0.01
R0410:Mycbp2 UTSW 14 103135133 missense probably damaging 1.00
R0530:Mycbp2 UTSW 14 103182459 missense probably damaging 1.00
R0591:Mycbp2 UTSW 14 103196391 unclassified probably benign
R0671:Mycbp2 UTSW 14 103194588 missense possibly damaging 0.95
R0755:Mycbp2 UTSW 14 103174794 missense probably damaging 1.00
R0817:Mycbp2 UTSW 14 103229418 missense probably damaging 0.99
R0818:Mycbp2 UTSW 14 103229418 missense probably damaging 0.99
R0819:Mycbp2 UTSW 14 103229418 missense probably damaging 0.99
R0881:Mycbp2 UTSW 14 103220013 missense probably benign
R0903:Mycbp2 UTSW 14 103275857 missense probably damaging 0.99
R0940:Mycbp2 UTSW 14 103262693 unclassified probably benign
R0961:Mycbp2 UTSW 14 103184835 missense probably damaging 1.00
R1004:Mycbp2 UTSW 14 103140917 missense probably benign 0.00
R1138:Mycbp2 UTSW 14 103174826 missense possibly damaging 0.84
R1170:Mycbp2 UTSW 14 103200152 nonsense probably null
R1211:Mycbp2 UTSW 14 103120563 missense probably benign 0.31
R1268:Mycbp2 UTSW 14 103208782 missense probably damaging 1.00
R1298:Mycbp2 UTSW 14 103155898 missense probably damaging 1.00
R1341:Mycbp2 UTSW 14 103298867 splice site probably benign
R1469:Mycbp2 UTSW 14 103188520 missense probably damaging 0.99
R1469:Mycbp2 UTSW 14 103188520 missense probably damaging 0.99
R1513:Mycbp2 UTSW 14 103204389 missense probably damaging 1.00
R1528:Mycbp2 UTSW 14 103232597 missense possibly damaging 0.91
R1564:Mycbp2 UTSW 14 103169851 splice site probably null
R1565:Mycbp2 UTSW 14 103252509 missense possibly damaging 0.82
R1656:Mycbp2 UTSW 14 103247758 missense probably damaging 1.00
R1694:Mycbp2 UTSW 14 103227511 missense probably damaging 1.00
R1709:Mycbp2 UTSW 14 103224416 missense probably damaging 1.00
R1728:Mycbp2 UTSW 14 103155178 missense probably damaging 0.98
R1751:Mycbp2 UTSW 14 103248405 missense probably damaging 0.98
R1767:Mycbp2 UTSW 14 103248405 missense probably damaging 0.98
R1772:Mycbp2 UTSW 14 103182419 missense probably damaging 1.00
R1784:Mycbp2 UTSW 14 103155178 missense probably damaging 0.98
R1823:Mycbp2 UTSW 14 103252509 missense possibly damaging 0.82
R1824:Mycbp2 UTSW 14 103252509 missense possibly damaging 0.82
R1844:Mycbp2 UTSW 14 103155714 missense possibly damaging 0.94
R1916:Mycbp2 UTSW 14 103184883 missense probably damaging 1.00
R1944:Mycbp2 UTSW 14 103229404 missense probably damaging 1.00
R1983:Mycbp2 UTSW 14 103145971 missense probably damaging 0.97
R2002:Mycbp2 UTSW 14 103248403 missense probably damaging 0.98
R2031:Mycbp2 UTSW 14 103188592 missense probably damaging 1.00
R2035:Mycbp2 UTSW 14 103260239 missense probably damaging 1.00
R2048:Mycbp2 UTSW 14 103232524 critical splice donor site probably null
R2061:Mycbp2 UTSW 14 103287260 missense probably damaging 0.99
R2113:Mycbp2 UTSW 14 103220076 missense probably damaging 0.99
R2128:Mycbp2 UTSW 14 103201230 missense probably benign 0.01
R2134:Mycbp2 UTSW 14 103208893 missense probably damaging 1.00
R2135:Mycbp2 UTSW 14 103145942 missense probably benign
R2135:Mycbp2 UTSW 14 103208893 missense probably damaging 1.00
R2146:Mycbp2 UTSW 14 103155922 missense probably damaging 0.97
R2147:Mycbp2 UTSW 14 103155922 missense probably damaging 0.97
R2148:Mycbp2 UTSW 14 103155922 missense probably damaging 0.97
R2150:Mycbp2 UTSW 14 103155922 missense probably damaging 0.97
R2163:Mycbp2 UTSW 14 103169855 critical splice donor site probably null
R2248:Mycbp2 UTSW 14 103169859 missense possibly damaging 0.50
R2265:Mycbp2 UTSW 14 103262749 missense probably benign 0.39
R2272:Mycbp2 UTSW 14 103144338 missense probably null 0.66
R2379:Mycbp2 UTSW 14 103174950 missense probably benign
R2495:Mycbp2 UTSW 14 103200118 missense probably damaging 0.99
R2508:Mycbp2 UTSW 14 103131245 missense probably damaging 0.99
R2510:Mycbp2 UTSW 14 103155255 missense probably damaging 0.96
R2851:Mycbp2 UTSW 14 103144333 missense probably damaging 0.99
R2852:Mycbp2 UTSW 14 103144333 missense probably damaging 0.99
R2965:Mycbp2 UTSW 14 103297358 missense probably benign 0.00
R3156:Mycbp2 UTSW 14 103208743 splice site probably benign
R3404:Mycbp2 UTSW 14 103200114 missense probably damaging 0.99
R3410:Mycbp2 UTSW 14 103135117 missense probably damaging 1.00
R3429:Mycbp2 UTSW 14 103229430 missense probably damaging 1.00
R3706:Mycbp2 UTSW 14 103156414 missense probably benign 0.31
R3772:Mycbp2 UTSW 14 103133788 missense possibly damaging 0.82
R3778:Mycbp2 UTSW 14 103197285 missense probably damaging 0.99
R3883:Mycbp2 UTSW 14 103295250 missense probably damaging 0.97
R3884:Mycbp2 UTSW 14 103295250 missense probably damaging 0.97
R3887:Mycbp2 UTSW 14 103174797 missense probably damaging 0.98
R3923:Mycbp2 UTSW 14 103126713 missense probably damaging 1.00
R3926:Mycbp2 UTSW 14 103204500 missense probably damaging 1.00
R3959:Mycbp2 UTSW 14 103295252 missense probably benign 0.00
R3966:Mycbp2 UTSW 14 103138725 splice site probably benign
R4021:Mycbp2 UTSW 14 103152157 missense probably damaging 0.97
R4363:Mycbp2 UTSW 14 103248457 missense probably damaging 1.00
R4405:Mycbp2 UTSW 14 103123445 missense probably damaging 1.00
R4407:Mycbp2 UTSW 14 103287228 missense probably damaging 1.00
R4410:Mycbp2 UTSW 14 103135266 missense probably damaging 1.00
R4434:Mycbp2 UTSW 14 103133789 missense probably damaging 0.99
R4448:Mycbp2 UTSW 14 103188502 missense possibly damaging 0.89
R4452:Mycbp2 UTSW 14 103155658 missense probably damaging 0.99
R4573:Mycbp2 UTSW 14 103346297 missense probably benign 0.05
R4589:Mycbp2 UTSW 14 103177313 missense probably benign 0.04
R4621:Mycbp2 UTSW 14 103219979 missense probably benign 0.12
R4622:Mycbp2 UTSW 14 103219979 missense probably benign 0.12
R4729:Mycbp2 UTSW 14 103188591 missense probably damaging 1.00
R4770:Mycbp2 UTSW 14 103219944 missense probably benign 0.41
R4790:Mycbp2 UTSW 14 103229437 missense probably damaging 1.00
R4884:Mycbp2 UTSW 14 103211295 missense probably damaging 1.00
R4885:Mycbp2 UTSW 14 103145946 missense possibly damaging 0.86
R4956:Mycbp2 UTSW 14 103287239 missense probably damaging 0.99
R4980:Mycbp2 UTSW 14 103260385 intron probably null
R4994:Mycbp2 UTSW 14 103169994 missense probably benign
R5029:Mycbp2 UTSW 14 103156510 missense probably benign 0.21
R5038:Mycbp2 UTSW 14 103296939 missense probably damaging 1.00
R5044:Mycbp2 UTSW 14 103139235 critical splice donor site probably null
R5231:Mycbp2 UTSW 14 103346214 critical splice donor site probably null
R5305:Mycbp2 UTSW 14 103346321 missense probably benign 0.00
R5322:Mycbp2 UTSW 14 103185683 critical splice acceptor site probably null
R5376:Mycbp2 UTSW 14 103242432 nonsense probably null
R5414:Mycbp2 UTSW 14 103306261 missense probably damaging 1.00
R5453:Mycbp2 UTSW 14 103201401 missense probably damaging 0.99
R5462:Mycbp2 UTSW 14 103200126 missense probably damaging 1.00
R5499:Mycbp2 UTSW 14 103242179 missense probably damaging 1.00
R5524:Mycbp2 UTSW 14 103295237 missense probably damaging 1.00
R5533:Mycbp2 UTSW 14 103282645 nonsense probably null
R5569:Mycbp2 UTSW 14 103135243 missense probably damaging 1.00
R5574:Mycbp2 UTSW 14 103142767 missense possibly damaging 0.94
R5579:Mycbp2 UTSW 14 103291333 missense probably damaging 0.98
R5590:Mycbp2 UTSW 14 103123355 missense probably damaging 1.00
R5592:Mycbp2 UTSW 14 103194677 missense probably benign 0.02
R5643:Mycbp2 UTSW 14 103287334 missense probably damaging 1.00
R5644:Mycbp2 UTSW 14 103287334 missense probably damaging 1.00
R5645:Mycbp2 UTSW 14 103188608 missense probably damaging 1.00
R5645:Mycbp2 UTSW 14 103188615 critical splice acceptor site probably null
R5646:Mycbp2 UTSW 14 103169910 missense probably benign 0.09
R5648:Mycbp2 UTSW 14 103291342 missense probably damaging 1.00
R5651:Mycbp2 UTSW 14 103282665 missense probably null 0.99
R5668:Mycbp2 UTSW 14 103120519 missense possibly damaging 0.62
R5745:Mycbp2 UTSW 14 103156453 missense possibly damaging 0.94
R5751:Mycbp2 UTSW 14 103148550 missense probably damaging 0.99
R5756:Mycbp2 UTSW 14 103133974 missense probably damaging 0.99
R5837:Mycbp2 UTSW 14 103124403 missense probably damaging 1.00
R5984:Mycbp2 UTSW 14 103126684 missense probably damaging 0.98
R6005:Mycbp2 UTSW 14 103156723 missense probably benign
R6063:Mycbp2 UTSW 14 103135146 missense probably damaging 1.00
R6091:Mycbp2 UTSW 14 103223046 missense probably damaging 1.00
R6120:Mycbp2 UTSW 14 103275887 missense probably benign 0.01
R6129:Mycbp2 UTSW 14 103285400 missense probably benign 0.21
R6147:Mycbp2 UTSW 14 103155509 nonsense probably null
R6161:Mycbp2 UTSW 14 103298747 missense probably damaging 1.00
R6187:Mycbp2 UTSW 14 103147017 missense probably damaging 1.00
R6208:Mycbp2 UTSW 14 103295228 missense probably benign 0.11
R6228:Mycbp2 UTSW 14 103260229 missense probably benign 0.24
R6301:Mycbp2 UTSW 14 103155426 missense probably damaging 1.00
R6311:Mycbp2 UTSW 14 103262740 missense possibly damaging 0.93
R6329:Mycbp2 UTSW 14 103155852 missense probably benign 0.00
R6439:Mycbp2 UTSW 14 103155475 missense probably benign 0.00
R6462:Mycbp2 UTSW 14 103136557 critical splice donor site probably null
R6528:Mycbp2 UTSW 14 103142881 missense probably damaging 0.99
R6736:Mycbp2 UTSW 14 103191567 missense probably null 1.00
R6821:Mycbp2 UTSW 14 103139409 missense probably damaging 1.00
R6851:Mycbp2 UTSW 14 103260194 critical splice donor site probably null
R6948:Mycbp2 UTSW 14 103285267 missense possibly damaging 0.94
R6977:Mycbp2 UTSW 14 103154906 missense probably damaging 0.99
R6985:Mycbp2 UTSW 14 103206681 missense possibly damaging 0.79
R7035:Mycbp2 UTSW 14 103174981 missense probably benign
R7054:Mycbp2 UTSW 14 103156098 missense possibly damaging 0.90
R7108:Mycbp2 UTSW 14 103122603 missense probably damaging 1.00
R7117:Mycbp2 UTSW 14 103154077 missense probably benign 0.21
R7137:Mycbp2 UTSW 14 103282679 missense possibly damaging 0.94
R7169:Mycbp2 UTSW 14 103260200 missense possibly damaging 0.78
R7218:Mycbp2 UTSW 14 103133846 missense probably benign
R7234:Mycbp2 UTSW 14 103215337 missense probably damaging 0.98
R7238:Mycbp2 UTSW 14 103156297 missense probably damaging 1.00
R7244:Mycbp2 UTSW 14 103208909 missense probably damaging 0.98
R7265:Mycbp2 UTSW 14 103197243 critical splice donor site probably null
R7286:Mycbp2 UTSW 14 103120591 missense probably damaging 1.00
R7332:Mycbp2 UTSW 14 103156453 missense probably damaging 1.00
R7332:Mycbp2 UTSW 14 103197357 missense probably damaging 0.97
R7384:Mycbp2 UTSW 14 103276393 missense probably damaging 0.99
R7392:Mycbp2 UTSW 14 103152191 missense probably damaging 1.00
R7392:Mycbp2 UTSW 14 103243128 missense probably damaging 0.99
R7409:Mycbp2 UTSW 14 103288744 missense probably damaging 1.00
R7486:Mycbp2 UTSW 14 103197254 missense probably damaging 0.97
R7643:Mycbp2 UTSW 14 103346265 missense probably benign
R7661:Mycbp2 UTSW 14 103212623 missense probably damaging 1.00
R7663:Mycbp2 UTSW 14 103191609 missense probably damaging 0.99
R7730:Mycbp2 UTSW 14 103123355 missense probably damaging 0.99
R7757:Mycbp2 UTSW 14 103191619 missense probably damaging 1.00
R7773:Mycbp2 UTSW 14 103248404 missense probably damaging 0.97
R7787:Mycbp2 UTSW 14 103127097 missense probably damaging 1.00
R7822:Mycbp2 UTSW 14 103139415 missense probably benign 0.00
R7838:Mycbp2 UTSW 14 103177293 missense probably benign 0.10
R7841:Mycbp2 UTSW 14 103146831 critical splice donor site probably null
R7858:Mycbp2 UTSW 14 103156305 missense probably damaging 1.00
R7873:Mycbp2 UTSW 14 103156146 missense probably damaging 1.00
R7911:Mycbp2 UTSW 14 103200185 missense probably damaging 0.99
R7921:Mycbp2 UTSW 14 103177293 missense probably benign 0.10
R7924:Mycbp2 UTSW 14 103146831 critical splice donor site probably null
R7941:Mycbp2 UTSW 14 103156305 missense probably damaging 1.00
R7956:Mycbp2 UTSW 14 103156146 missense probably damaging 1.00
R7992:Mycbp2 UTSW 14 103200185 missense probably damaging 0.99
X0024:Mycbp2 UTSW 14 103146942 missense probably damaging 1.00
Z1176:Mycbp2 UTSW 14 103156637 missense probably benign 0.06
Z1176:Mycbp2 UTSW 14 103346249 missense probably benign
Z1177:Mycbp2 UTSW 14 103127063 critical splice donor site probably null
Z1177:Mycbp2 UTSW 14 103135123 missense probably damaging 1.00
Z1177:Mycbp2 UTSW 14 103169873 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- GTGATTTTCTCCGTTATGGACATTC -3'
(R):5'- ATTTCACCTGGATGCCCTG -3'

Sequencing Primer
(F):5'- CCGTTATGGACATTCATATAGTACTC -3'
(R):5'- TGCCCTGAGAGAGTTAAGCCAATC -3'
Posted On2016-10-05