Incidental Mutation 'R2128:Mycbp2'
ID227769
Institutional Source Beutler Lab
Gene Symbol Mycbp2
Ensembl Gene ENSMUSG00000033004
Gene NameMYC binding protein 2
SynonymsC130061D10Rik, Phr1, Pam
MMRRC Submission 040131-MU
Accession Numbers

Genbank: NM_207215; MGI: 2179432

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2128 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location103113411-103346814 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 103201230 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 2072 (M2072V)
Ref Sequence ENSEMBL: ENSMUSP00000124601 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159855] [ENSMUST00000160758]
Predicted Effect probably benign
Transcript: ENSMUST00000159855
AA Change: M2105V

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000124710
Gene: ENSMUSG00000033004
AA Change: M2105V

DomainStartEndE-ValueType
low complexity region 5 27 N/A INTRINSIC
low complexity region 47 55 N/A INTRINSIC
low complexity region 100 127 N/A INTRINSIC
low complexity region 178 191 N/A INTRINSIC
Pfam:RCC1_2 683 712 1.4e-10 PFAM
low complexity region 737 750 N/A INTRINSIC
low complexity region 793 815 N/A INTRINSIC
Pfam:RCC1_2 942 971 5.5e-10 PFAM
Pfam:RCC1 958 1006 4.8e-15 PFAM
Pfam:PHR 1235 1385 8.2e-44 PFAM
Pfam:PHR 1723 1880 1.4e-43 PFAM
low complexity region 1935 1948 N/A INTRINSIC
low complexity region 2182 2195 N/A INTRINSIC
Pfam:Filamin 2261 2431 7.5e-9 PFAM
Pfam:SH3_3 2472 2539 4.1e-9 PFAM
internal_repeat_3 2612 2679 1.69e-7 PROSPERO
low complexity region 2701 2710 N/A INTRINSIC
low complexity region 2884 2917 N/A INTRINSIC
low complexity region 2970 2984 N/A INTRINSIC
coiled coil region 3263 3290 N/A INTRINSIC
low complexity region 3352 3365 N/A INTRINSIC
low complexity region 3418 3433 N/A INTRINSIC
low complexity region 3678 3695 N/A INTRINSIC
APC10 3810 3968 1.11e-18 SMART
low complexity region 4103 4115 N/A INTRINSIC
low complexity region 4190 4212 N/A INTRINSIC
Blast:BBOX 4327 4370 7e-7 BLAST
RING 4496 4546 5.35e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160758
AA Change: M2072V

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000124601
Gene: ENSMUSG00000033004
AA Change: M2072V

DomainStartEndE-ValueType
low complexity region 14 22 N/A INTRINSIC
low complexity region 67 94 N/A INTRINSIC
low complexity region 145 158 N/A INTRINSIC
Pfam:RCC1_2 650 679 1e-10 PFAM
low complexity region 704 717 N/A INTRINSIC
low complexity region 760 782 N/A INTRINSIC
Pfam:RCC1_2 909 938 1.5e-9 PFAM
Pfam:RCC1 925 973 1.3e-15 PFAM
Pfam:PHR 1202 1353 1.6e-50 PFAM
Pfam:PHR 1690 1848 3.1e-58 PFAM
low complexity region 1902 1915 N/A INTRINSIC
low complexity region 2149 2162 N/A INTRINSIC
Pfam:Filamin 2228 2398 7.6e-9 PFAM
Pfam:SH3_3 2439 2507 2.3e-10 PFAM
internal_repeat_3 2554 2621 2e-7 PROSPERO
low complexity region 2643 2652 N/A INTRINSIC
low complexity region 2774 2807 N/A INTRINSIC
low complexity region 2860 2874 N/A INTRINSIC
coiled coil region 3153 3180 N/A INTRINSIC
low complexity region 3242 3255 N/A INTRINSIC
low complexity region 3308 3323 N/A INTRINSIC
low complexity region 3568 3585 N/A INTRINSIC
APC10 3700 3858 1.11e-18 SMART
low complexity region 3993 4005 N/A INTRINSIC
low complexity region 4080 4102 N/A INTRINSIC
Blast:BBOX 4217 4260 7e-7 BLAST
RING 4386 4436 5.35e-5 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted allele exhibit neonatal lethality, defective diaphragm innervation, abnormal brain morphology and defective axonal guidance. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(5) Chemically induced(3)

Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik A G 10: 87,230,204 E249G possibly damaging Het
2610028H24Rik A G 10: 76,457,515 M136V possibly damaging Het
4930523C07Rik A T 1: 160,075,375 K72* probably null Het
Abca6 A G 11: 110,219,649 I558T probably benign Het
Acot10 T C 15: 20,666,626 T10A probably benign Het
Adgrl4 T A 3: 151,500,201 D233E probably benign Het
Adgrv1 A T 13: 81,557,080 F1537Y probably damaging Het
Akap2 A G 4: 57,854,890 Y134C probably benign Het
Aqp3 T A 4: 41,098,061 I17F probably benign Het
Arap1 T A 7: 101,409,320 L1375H probably damaging Het
Aspm T C 1: 139,457,635 V339A probably benign Het
Atp13a3 G A 16: 30,354,276 A261V probably damaging Het
Casp8ap2 T C 4: 32,640,142 Y399H probably benign Het
Cept1 A G 3: 106,512,879 V213A probably damaging Het
Cit A G 5: 115,985,507 D1469G possibly damaging Het
Cnga2 A G X: 72,007,788 Y182C possibly damaging Het
Cox20 A G 1: 178,321,947 I54V probably benign Het
Dhx8 C A 11: 101,738,409 D261E probably benign Het
Dnah2 A T 11: 69,458,185 I2486N probably benign Het
Dnah5 A G 15: 28,408,321 Q3484R probably benign Het
Drd1 T C 13: 54,053,553 Y207C probably damaging Het
Dtl C T 1: 191,558,110 V222I probably damaging Het
Dync1h1 T C 12: 110,640,882 Y2636H probably damaging Het
Endog C A 2: 30,172,036 D154E probably benign Het
Epc1 A T 18: 6,462,954 V14E probably damaging Het
Ercc4 C A 16: 13,147,934 T810K probably damaging Het
Fam43b T A 4: 138,395,988 N7I possibly damaging Het
Fgd1 T C X: 151,086,217 probably null Het
Filip1 G T 9: 79,819,330 T669N probably damaging Het
Fndc1 A G 17: 7,778,665 probably benign Het
Foxk1 C A 5: 142,435,188 S189* probably null Het
Gatm T C 2: 122,600,536 N274S probably damaging Het
Gdf9 A G 11: 53,437,507 Y430C probably damaging Het
Gga1 C T 15: 78,888,448 P260S probably damaging Het
Gm11595 A T 11: 99,772,501 C118S unknown Het
Gm382 G T X: 127,062,651 V820L possibly damaging Het
Gzmk T A 13: 113,172,014 I179F probably damaging Het
Hsp90b1 T C 10: 86,695,706 D421G probably damaging Het
Hus1 A G 11: 9,006,011 M174T probably damaging Het
Ifngr2 T A 16: 91,562,873 Y289* probably null Het
Il6st T A 13: 112,504,175 H828Q probably benign Het
Impg2 T A 16: 56,218,379 Y127N probably damaging Het
Irf3 T A 7: 45,001,744 W345R probably damaging Het
Kif1b G A 4: 149,187,640 S1568L possibly damaging Het
Klhl42 A G 6: 147,101,753 T342A probably benign Het
Kndc1 G T 7: 139,930,112 R1289L probably damaging Het
Knl1 A T 2: 119,071,819 T1334S possibly damaging Het
L3mbtl3 G T 10: 26,313,868 D499E unknown Het
Ldhd T A 8: 111,627,048 M478L probably benign Het
Loxl4 C G 19: 42,603,963 E385D probably damaging Het
Lrriq1 G A 10: 103,214,857 T678I probably benign Het
Macf1 T A 4: 123,492,774 I1017F probably benign Het
Madcam1 A G 10: 79,665,572 E157G possibly damaging Het
Mamdc4 T C 2: 25,569,258 D195G probably damaging Het
Mctp1 A G 13: 76,824,822 D648G probably damaging Het
Nck1 A G 9: 100,497,547 probably null Het
Ndufaf4 G T 4: 24,898,608 D55Y probably damaging Het
Nek11 A T 9: 105,300,361 D230E probably benign Het
Nit2 T C 16: 57,161,196 K67E possibly damaging Het
Olfr2 T C 7: 107,001,248 D204G probably damaging Het
Olfr290 T C 7: 84,916,493 F238S probably damaging Het
Olfr527 C T 7: 140,336,429 T189M probably damaging Het
Olfr802 A T 10: 129,682,532 V69E possibly damaging Het
Pccb G C 9: 100,985,831 D347E probably damaging Het
Plcl1 T A 1: 55,697,838 F779L probably damaging Het
Prune2 C A 19: 17,122,422 D1763E probably benign Het
Pwwp2a A G 11: 43,705,318 S437G probably benign Het
Rabgap1l A T 1: 160,738,957 D90E probably benign Het
Rapgef4 T A 2: 72,226,553 I552N possibly damaging Het
Scn7a A T 2: 66,697,986 I720K probably damaging Het
Scn9a T A 2: 66,526,654 N1101I probably damaging Het
Siglec1 A T 2: 131,080,497 Y553N probably damaging Het
Slc22a23 A G 13: 34,203,970 L381P possibly damaging Het
Slc7a11 T A 3: 50,384,109 T284S probably damaging Het
Slc8a2 T A 7: 16,140,492 probably null Het
Snx29 T A 16: 11,400,971 S224T probably damaging Het
Stox1 T C 10: 62,664,535 T749A probably benign Het
Tg A G 15: 66,694,894 I1264V probably benign Het
Tmem110 T C 14: 30,866,624 Y103H probably damaging Het
Top2a A C 11: 99,009,807 V609G probably damaging Het
Trmt44 G A 5: 35,574,832 P72S probably benign Het
Ttll3 G C 6: 113,412,934 S760T probably benign Het
Ttn T C 2: 76,748,678 D23957G probably damaging Het
Ttn G A 2: 76,833,897 probably benign Het
Ubxn1 T G 19: 8,872,070 V59G probably benign Het
Ubxn4 T C 1: 128,244,510 S14P probably benign Het
Uso1 T A 5: 92,195,370 M771K probably benign Het
Utp20 A G 10: 88,814,055 F431S probably damaging Het
Vmn1r206 T C 13: 22,620,612 S142G probably benign Het
Vmn2r19 A G 6: 123,308,330 probably null Het
Vps36 G T 8: 22,218,289 probably null Het
Wnt3 A G 11: 103,812,648 H319R possibly damaging Het
Zbtb26 G T 2: 37,436,551 Q158K probably benign Het
Zfp648 T C 1: 154,204,607 S171P probably benign Het
Other mutations in Mycbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Mycbp2 APN 14 103223050 missense probably damaging 1.00
IGL00518:Mycbp2 APN 14 103155808 missense probably damaging 1.00
IGL00650:Mycbp2 APN 14 103143228 missense probably damaging 0.97
IGL00653:Mycbp2 APN 14 103143228 missense probably damaging 0.97
IGL00742:Mycbp2 APN 14 103201352 missense probably damaging 1.00
IGL00755:Mycbp2 APN 14 103194621 missense possibly damaging 0.72
IGL00793:Mycbp2 APN 14 103126753 missense possibly damaging 0.77
IGL00916:Mycbp2 APN 14 103291283 splice site probably benign
IGL00960:Mycbp2 APN 14 103229384 missense possibly damaging 0.95
IGL00977:Mycbp2 APN 14 103172642 missense probably damaging 0.98
IGL01349:Mycbp2 APN 14 103122547 missense probably damaging 0.98
IGL01369:Mycbp2 APN 14 103155510 missense possibly damaging 0.61
IGL01410:Mycbp2 APN 14 103229492 splice site probably null
IGL01586:Mycbp2 APN 14 103140869 critical splice donor site probably null
IGL01593:Mycbp2 APN 14 103291287 critical splice donor site probably null
IGL01693:Mycbp2 APN 14 103127979 missense probably damaging 0.99
IGL01730:Mycbp2 APN 14 103135204 nonsense probably null
IGL01820:Mycbp2 APN 14 103188501 missense probably damaging 1.00
IGL01974:Mycbp2 APN 14 103143211 missense possibly damaging 0.88
IGL02071:Mycbp2 APN 14 103154907 nonsense probably null
IGL02178:Mycbp2 APN 14 103224366 missense probably benign 0.01
IGL02324:Mycbp2 APN 14 103242207 missense probably damaging 1.00
IGL02442:Mycbp2 APN 14 103314375 missense probably benign
IGL02607:Mycbp2 APN 14 103285273 missense probably damaging 1.00
IGL02679:Mycbp2 APN 14 103205185 missense probably benign
IGL02702:Mycbp2 APN 14 103220124 missense probably benign 0.01
IGL02709:Mycbp2 APN 14 103155261 missense probably damaging 0.97
IGL02736:Mycbp2 APN 14 103114242 splice site probably benign
IGL02866:Mycbp2 APN 14 103129992 missense probably damaging 0.98
IGL02939:Mycbp2 APN 14 103177279 missense probably benign
IGL03082:Mycbp2 APN 14 103204369 missense probably benign 0.23
IGL03142:Mycbp2 APN 14 103298776 missense probably damaging 0.99
IGL03155:Mycbp2 APN 14 103155453 missense probably benign 0.06
IGL03236:Mycbp2 APN 14 103298698 missense probably damaging 0.99
IGL03256:Mycbp2 APN 14 103188589 missense possibly damaging 0.92
IGL03303:Mycbp2 APN 14 103247758 missense probably damaging 1.00
decompose UTSW 14 103219979 missense probably benign 0.12
moulder UTSW 14 103188592 missense probably damaging 1.00
N/A - 293:Mycbp2 UTSW 14 103224462 splice site probably benign
R0040:Mycbp2 UTSW 14 103224272 missense probably benign 0.11
R0040:Mycbp2 UTSW 14 103224272 missense probably benign 0.11
R0057:Mycbp2 UTSW 14 103152142 missense probably damaging 0.97
R0063:Mycbp2 UTSW 14 103156634 unclassified probably benign
R0097:Mycbp2 UTSW 14 103155762 missense probably damaging 1.00
R0097:Mycbp2 UTSW 14 103155762 missense probably damaging 1.00
R0268:Mycbp2 UTSW 14 103314325 nonsense probably null
R0388:Mycbp2 UTSW 14 103156667 missense probably benign 0.01
R0410:Mycbp2 UTSW 14 103135133 missense probably damaging 1.00
R0530:Mycbp2 UTSW 14 103182459 missense probably damaging 1.00
R0591:Mycbp2 UTSW 14 103196391 unclassified probably benign
R0671:Mycbp2 UTSW 14 103194588 missense possibly damaging 0.95
R0755:Mycbp2 UTSW 14 103174794 missense probably damaging 1.00
R0817:Mycbp2 UTSW 14 103229418 missense probably damaging 0.99
R0818:Mycbp2 UTSW 14 103229418 missense probably damaging 0.99
R0819:Mycbp2 UTSW 14 103229418 missense probably damaging 0.99
R0881:Mycbp2 UTSW 14 103220013 missense probably benign
R0903:Mycbp2 UTSW 14 103275857 missense probably damaging 0.99
R0940:Mycbp2 UTSW 14 103262693 unclassified probably benign
R0961:Mycbp2 UTSW 14 103184835 missense probably damaging 1.00
R1004:Mycbp2 UTSW 14 103140917 missense probably benign 0.00
R1138:Mycbp2 UTSW 14 103174826 missense possibly damaging 0.84
R1170:Mycbp2 UTSW 14 103200152 nonsense probably null
R1211:Mycbp2 UTSW 14 103120563 missense probably benign 0.31
R1268:Mycbp2 UTSW 14 103208782 missense probably damaging 1.00
R1298:Mycbp2 UTSW 14 103155898 missense probably damaging 1.00
R1341:Mycbp2 UTSW 14 103298867 splice site probably benign
R1469:Mycbp2 UTSW 14 103188520 missense probably damaging 0.99
R1469:Mycbp2 UTSW 14 103188520 missense probably damaging 0.99
R1513:Mycbp2 UTSW 14 103204389 missense probably damaging 1.00
R1528:Mycbp2 UTSW 14 103232597 missense possibly damaging 0.91
R1564:Mycbp2 UTSW 14 103169851 splice site probably null
R1565:Mycbp2 UTSW 14 103252509 missense possibly damaging 0.82
R1656:Mycbp2 UTSW 14 103247758 missense probably damaging 1.00
R1694:Mycbp2 UTSW 14 103227511 missense probably damaging 1.00
R1709:Mycbp2 UTSW 14 103224416 missense probably damaging 1.00
R1728:Mycbp2 UTSW 14 103155178 missense probably damaging 0.98
R1751:Mycbp2 UTSW 14 103248405 missense probably damaging 0.98
R1767:Mycbp2 UTSW 14 103248405 missense probably damaging 0.98
R1772:Mycbp2 UTSW 14 103182419 missense probably damaging 1.00
R1784:Mycbp2 UTSW 14 103155178 missense probably damaging 0.98
R1823:Mycbp2 UTSW 14 103252509 missense possibly damaging 0.82
R1824:Mycbp2 UTSW 14 103252509 missense possibly damaging 0.82
R1844:Mycbp2 UTSW 14 103155714 missense possibly damaging 0.94
R1916:Mycbp2 UTSW 14 103184883 missense probably damaging 1.00
R1944:Mycbp2 UTSW 14 103229404 missense probably damaging 1.00
R1983:Mycbp2 UTSW 14 103145971 missense probably damaging 0.97
R2002:Mycbp2 UTSW 14 103248403 missense probably damaging 0.98
R2031:Mycbp2 UTSW 14 103188592 missense probably damaging 1.00
R2035:Mycbp2 UTSW 14 103260239 missense probably damaging 1.00
R2048:Mycbp2 UTSW 14 103232524 critical splice donor site probably null
R2061:Mycbp2 UTSW 14 103287260 missense probably damaging 0.99
R2113:Mycbp2 UTSW 14 103220076 missense probably damaging 0.99
R2134:Mycbp2 UTSW 14 103208893 missense probably damaging 1.00
R2135:Mycbp2 UTSW 14 103145942 missense probably benign
R2135:Mycbp2 UTSW 14 103208893 missense probably damaging 1.00
R2146:Mycbp2 UTSW 14 103155922 missense probably damaging 0.97
R2147:Mycbp2 UTSW 14 103155922 missense probably damaging 0.97
R2148:Mycbp2 UTSW 14 103155922 missense probably damaging 0.97
R2150:Mycbp2 UTSW 14 103155922 missense probably damaging 0.97
R2163:Mycbp2 UTSW 14 103169855 critical splice donor site probably null
R2248:Mycbp2 UTSW 14 103169859 missense possibly damaging 0.50
R2265:Mycbp2 UTSW 14 103262749 missense probably benign 0.39
R2272:Mycbp2 UTSW 14 103144338 missense probably null 0.66
R2379:Mycbp2 UTSW 14 103174950 missense probably benign
R2495:Mycbp2 UTSW 14 103200118 missense probably damaging 0.99
R2508:Mycbp2 UTSW 14 103131245 missense probably damaging 0.99
R2510:Mycbp2 UTSW 14 103155255 missense probably damaging 0.96
R2851:Mycbp2 UTSW 14 103144333 missense probably damaging 0.99
R2852:Mycbp2 UTSW 14 103144333 missense probably damaging 0.99
R2965:Mycbp2 UTSW 14 103297358 missense probably benign 0.00
R3156:Mycbp2 UTSW 14 103208743 splice site probably benign
R3404:Mycbp2 UTSW 14 103200114 missense probably damaging 0.99
R3410:Mycbp2 UTSW 14 103135117 missense probably damaging 1.00
R3429:Mycbp2 UTSW 14 103229430 missense probably damaging 1.00
R3706:Mycbp2 UTSW 14 103156414 missense probably benign 0.31
R3772:Mycbp2 UTSW 14 103133788 missense possibly damaging 0.82
R3778:Mycbp2 UTSW 14 103197285 missense probably damaging 0.99
R3883:Mycbp2 UTSW 14 103295250 missense probably damaging 0.97
R3884:Mycbp2 UTSW 14 103295250 missense probably damaging 0.97
R3887:Mycbp2 UTSW 14 103174797 missense probably damaging 0.98
R3923:Mycbp2 UTSW 14 103126713 missense probably damaging 1.00
R3926:Mycbp2 UTSW 14 103204500 missense probably damaging 1.00
R3959:Mycbp2 UTSW 14 103295252 missense probably benign 0.00
R3966:Mycbp2 UTSW 14 103138725 splice site probably benign
R4021:Mycbp2 UTSW 14 103152157 missense probably damaging 0.97
R4363:Mycbp2 UTSW 14 103248457 missense probably damaging 1.00
R4405:Mycbp2 UTSW 14 103123445 missense probably damaging 1.00
R4407:Mycbp2 UTSW 14 103287228 missense probably damaging 1.00
R4410:Mycbp2 UTSW 14 103135266 missense probably damaging 1.00
R4434:Mycbp2 UTSW 14 103133789 missense probably damaging 0.99
R4448:Mycbp2 UTSW 14 103188502 missense possibly damaging 0.89
R4452:Mycbp2 UTSW 14 103155658 missense probably damaging 0.99
R4573:Mycbp2 UTSW 14 103346297 missense probably benign 0.05
R4589:Mycbp2 UTSW 14 103177313 missense probably benign 0.04
R4621:Mycbp2 UTSW 14 103219979 missense probably benign 0.12
R4622:Mycbp2 UTSW 14 103219979 missense probably benign 0.12
R4729:Mycbp2 UTSW 14 103188591 missense probably damaging 1.00
R4770:Mycbp2 UTSW 14 103219944 missense probably benign 0.41
R4790:Mycbp2 UTSW 14 103229437 missense probably damaging 1.00
R4884:Mycbp2 UTSW 14 103211295 missense probably damaging 1.00
R4885:Mycbp2 UTSW 14 103145946 missense possibly damaging 0.86
R4956:Mycbp2 UTSW 14 103287239 missense probably damaging 0.99
R4980:Mycbp2 UTSW 14 103260385 intron probably null
R4994:Mycbp2 UTSW 14 103169994 missense probably benign
R5029:Mycbp2 UTSW 14 103156510 missense probably benign 0.21
R5038:Mycbp2 UTSW 14 103296939 missense probably damaging 1.00
R5044:Mycbp2 UTSW 14 103139235 critical splice donor site probably null
R5231:Mycbp2 UTSW 14 103346214 critical splice donor site probably null
R5305:Mycbp2 UTSW 14 103346321 missense probably benign 0.00
R5322:Mycbp2 UTSW 14 103185683 critical splice acceptor site probably null
R5376:Mycbp2 UTSW 14 103242432 nonsense probably null
R5414:Mycbp2 UTSW 14 103306261 missense probably damaging 1.00
R5453:Mycbp2 UTSW 14 103201401 missense probably damaging 0.99
R5462:Mycbp2 UTSW 14 103200126 missense probably damaging 1.00
R5499:Mycbp2 UTSW 14 103242179 missense probably damaging 1.00
R5502:Mycbp2 UTSW 14 103173814 missense probably damaging 1.00
R5524:Mycbp2 UTSW 14 103295237 missense probably damaging 1.00
R5533:Mycbp2 UTSW 14 103282645 nonsense probably null
R5569:Mycbp2 UTSW 14 103135243 missense probably damaging 1.00
R5574:Mycbp2 UTSW 14 103142767 missense possibly damaging 0.94
R5579:Mycbp2 UTSW 14 103291333 missense probably damaging 0.98
R5590:Mycbp2 UTSW 14 103123355 missense probably damaging 1.00
R5592:Mycbp2 UTSW 14 103194677 missense probably benign 0.02
R5643:Mycbp2 UTSW 14 103287334 missense probably damaging 1.00
R5644:Mycbp2 UTSW 14 103287334 missense probably damaging 1.00
R5645:Mycbp2 UTSW 14 103188608 missense probably damaging 1.00
R5645:Mycbp2 UTSW 14 103188615 critical splice acceptor site probably null
R5646:Mycbp2 UTSW 14 103169910 missense probably benign 0.09
R5648:Mycbp2 UTSW 14 103291342 missense probably damaging 1.00
R5651:Mycbp2 UTSW 14 103282665 missense probably null 0.99
R5668:Mycbp2 UTSW 14 103120519 missense possibly damaging 0.62
R5745:Mycbp2 UTSW 14 103156453 missense possibly damaging 0.94
R5751:Mycbp2 UTSW 14 103148550 missense probably damaging 0.99
R5756:Mycbp2 UTSW 14 103133974 missense probably damaging 0.99
R5837:Mycbp2 UTSW 14 103124403 missense probably damaging 1.00
R5984:Mycbp2 UTSW 14 103126684 missense probably damaging 0.98
R6005:Mycbp2 UTSW 14 103156723 missense probably benign
R6063:Mycbp2 UTSW 14 103135146 missense probably damaging 1.00
R6091:Mycbp2 UTSW 14 103223046 missense probably damaging 1.00
R6120:Mycbp2 UTSW 14 103275887 missense probably benign 0.01
R6129:Mycbp2 UTSW 14 103285400 missense probably benign 0.21
R6147:Mycbp2 UTSW 14 103155509 nonsense probably null
R6161:Mycbp2 UTSW 14 103298747 missense probably damaging 1.00
R6187:Mycbp2 UTSW 14 103147017 missense probably damaging 1.00
R6208:Mycbp2 UTSW 14 103295228 missense probably benign 0.11
R6228:Mycbp2 UTSW 14 103260229 missense probably benign 0.24
R6301:Mycbp2 UTSW 14 103155426 missense probably damaging 1.00
R6311:Mycbp2 UTSW 14 103262740 missense possibly damaging 0.93
R6329:Mycbp2 UTSW 14 103155852 missense probably benign 0.00
R6439:Mycbp2 UTSW 14 103155475 missense probably benign 0.00
R6462:Mycbp2 UTSW 14 103136557 critical splice donor site probably null
R6528:Mycbp2 UTSW 14 103142881 missense probably damaging 0.99
R6736:Mycbp2 UTSW 14 103191567 missense probably null 1.00
R6821:Mycbp2 UTSW 14 103139409 missense probably damaging 1.00
R6851:Mycbp2 UTSW 14 103260194 critical splice donor site probably null
R6948:Mycbp2 UTSW 14 103285267 missense possibly damaging 0.94
R6977:Mycbp2 UTSW 14 103154906 missense probably damaging 0.99
R6985:Mycbp2 UTSW 14 103206681 missense possibly damaging 0.79
R7035:Mycbp2 UTSW 14 103174981 missense probably benign
R7054:Mycbp2 UTSW 14 103156098 missense possibly damaging 0.90
R7108:Mycbp2 UTSW 14 103122603 missense probably damaging 1.00
R7117:Mycbp2 UTSW 14 103154077 missense probably benign 0.21
R7137:Mycbp2 UTSW 14 103282679 missense possibly damaging 0.94
R7169:Mycbp2 UTSW 14 103260200 missense possibly damaging 0.78
R7218:Mycbp2 UTSW 14 103133846 missense probably benign
R7234:Mycbp2 UTSW 14 103215337 missense probably damaging 0.98
R7238:Mycbp2 UTSW 14 103156297 missense probably damaging 1.00
R7244:Mycbp2 UTSW 14 103208909 missense probably damaging 0.98
R7265:Mycbp2 UTSW 14 103197243 critical splice donor site probably null
R7286:Mycbp2 UTSW 14 103120591 missense probably damaging 1.00
R7332:Mycbp2 UTSW 14 103156453 missense probably damaging 1.00
R7332:Mycbp2 UTSW 14 103197357 missense probably damaging 0.97
R7384:Mycbp2 UTSW 14 103276393 missense probably damaging 0.99
R7392:Mycbp2 UTSW 14 103152191 missense probably damaging 1.00
R7392:Mycbp2 UTSW 14 103243128 missense probably damaging 0.99
R7409:Mycbp2 UTSW 14 103288744 missense probably damaging 1.00
R7486:Mycbp2 UTSW 14 103197254 missense probably damaging 0.97
R7643:Mycbp2 UTSW 14 103346265 missense probably benign
R7661:Mycbp2 UTSW 14 103212623 missense probably damaging 1.00
R7663:Mycbp2 UTSW 14 103191609 missense probably damaging 0.99
R7730:Mycbp2 UTSW 14 103123355 missense probably damaging 0.99
R7757:Mycbp2 UTSW 14 103191619 missense probably damaging 1.00
R7773:Mycbp2 UTSW 14 103248404 missense probably damaging 0.97
R7787:Mycbp2 UTSW 14 103127097 missense probably damaging 1.00
R7822:Mycbp2 UTSW 14 103139415 missense probably benign 0.00
R7838:Mycbp2 UTSW 14 103177293 missense probably benign 0.10
R7841:Mycbp2 UTSW 14 103146831 critical splice donor site probably null
R7858:Mycbp2 UTSW 14 103156305 missense probably damaging 1.00
R7873:Mycbp2 UTSW 14 103156146 missense probably damaging 1.00
R7911:Mycbp2 UTSW 14 103200185 missense probably damaging 0.99
R7921:Mycbp2 UTSW 14 103177293 missense probably benign 0.10
R7924:Mycbp2 UTSW 14 103146831 critical splice donor site probably null
R7941:Mycbp2 UTSW 14 103156305 missense probably damaging 1.00
R7956:Mycbp2 UTSW 14 103156146 missense probably damaging 1.00
R7992:Mycbp2 UTSW 14 103200185 missense probably damaging 0.99
X0024:Mycbp2 UTSW 14 103146942 missense probably damaging 1.00
Z1176:Mycbp2 UTSW 14 103156637 missense probably benign 0.06
Z1176:Mycbp2 UTSW 14 103346249 missense probably benign
Z1177:Mycbp2 UTSW 14 103127063 critical splice donor site probably null
Z1177:Mycbp2 UTSW 14 103135123 missense probably damaging 1.00
Z1177:Mycbp2 UTSW 14 103169873 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- ACTTAGATGGGACCATGCCC -3'
(R):5'- TGGATGACAATCGAATTTGACC -3'

Sequencing Primer
(F):5'- AGATGGGACCATGCCCCTTTC -3'
(R):5'- CAATCGAATTTGACCCTCAGTGTGG -3'
Posted On2014-09-17