Incidental Mutation 'R5523:Pcdh12'
ID431718
Institutional Source Beutler Lab
Gene Symbol Pcdh12
Ensembl Gene ENSMUSG00000024440
Gene Nameprotocadherin 12
SynonymsVE-cadherin-2, vascular endothelial cadherin-2
MMRRC Submission 043265-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5523 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location38267092-38284402 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 38283139 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 311 (D311G)
Ref Sequence ENSEMBL: ENSMUSP00000025311 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025311] [ENSMUST00000194012]
Predicted Effect probably damaging
Transcript: ENSMUST00000025311
AA Change: D311G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025311
Gene: ENSMUSG00000024440
AA Change: D311G

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
CA 53 133 4.42e-2 SMART
CA 157 242 2.55e-17 SMART
CA 266 350 2.31e-24 SMART
CA 376 458 3.86e-26 SMART
CA 482 563 6.27e-26 SMART
CA 621 704 3.02e-2 SMART
transmembrane domain 716 738 N/A INTRINSIC
low complexity region 960 975 N/A INTRINSIC
low complexity region 1032 1041 N/A INTRINSIC
low complexity region 1115 1125 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193123
Predicted Effect probably benign
Transcript: ENSMUST00000194012
SMART Domains Protein: ENSMUSP00000141907
Gene: ENSMUSG00000024440

DomainStartEndE-ValueType
low complexity region 56 66 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.4%
  • 20x: 91.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the protocadherin gene family, a subfamily of the cadherin superfamily. The encoded protein consists of an extracellular domain containing 6 cadherin repeats, a transmembrane domain and a cytoplasmic tail that differs from those of the classical cadherins. The gene localizes to the region on chromosome 5 where the protocadherin gene clusters reside. The exon organization of this transcript is similar to that of the gene cluster transcripts, notably the first large exon, but no significant sequence homology exists. The function of this cellular adhesion protein is undetermined but mouse protocadherin 12 does not bind catenins and appears to have no affect on cell migration or growth. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation are viable, fertile and do not display any obvious histomorphological abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadm G A 3: 153,938,636 T70M probably benign Het
Adamtsl3 G A 7: 82,574,442 A218T possibly damaging Het
Ahnak2 T C 12: 112,775,208 D810G probably damaging Het
Ak7 T A 12: 105,741,082 L315* probably null Het
Apoa5 T C 9: 46,270,589 F321S possibly damaging Het
Baiap2l1 G C 5: 144,275,958 P416A probably damaging Het
Bco1 A G 8: 117,108,693 I128V possibly damaging Het
Bpifb2 T C 2: 153,875,985 probably benign Het
Cdt1 G A 8: 122,568,093 R13H possibly damaging Het
Cenpj A G 14: 56,552,423 V723A probably benign Het
Chl1 T A 6: 103,708,714 W849R probably damaging Het
Cpne9 A G 6: 113,290,231 D169G probably damaging Het
Cyp2d22 A G 15: 82,372,571 V334A probably damaging Het
Cyp4f39 C A 17: 32,470,833 N84K probably benign Het
Cyp4f40 T A 17: 32,669,822 F192I probably damaging Het
Disp3 T C 4: 148,258,097 D632G probably benign Het
Dnhd1 G A 7: 105,703,209 R2523Q probably damaging Het
Echs1 G T 7: 140,112,513 T107K probably benign Het
Ehmt2 C T 17: 34,899,091 R40* probably null Het
Ergic1 G A 17: 26,624,606 V17I probably damaging Het
Fank1 G T 7: 133,876,840 C210F probably damaging Het
Fbxo15 T G 18: 84,960,069 M136R probably damaging Het
Ggcx C A 6: 72,424,034 P240H probably damaging Het
Gpr179 T C 11: 97,336,782 R1516G probably benign Het
Gprin3 G A 6: 59,353,946 Q459* probably null Het
Hadha C A 5: 30,145,254 V99F possibly damaging Het
Hirip3 A G 7: 126,863,862 D330G possibly damaging Het
Irx2 T C 13: 72,631,595 W333R probably damaging Het
Kansl1l T C 1: 66,802,112 T10A probably benign Het
Kcnd2 T C 6: 21,723,212 I467T probably benign Het
Klc3 A T 7: 19,397,007 I215N probably damaging Het
Kmt2c A G 5: 25,299,339 V3657A probably benign Het
Lin28b A T 10: 45,469,068 L54* probably null Het
Mgll T C 6: 88,725,761 V14A probably benign Het
Mrc2 A G 11: 105,343,582 N976S probably benign Het
Myh8 C A 11: 67,305,962 A1807E possibly damaging Het
Nalcn G A 14: 123,409,743 P573S probably damaging Het
Ncam2 C T 16: 81,434,878 R77* probably null Het
Neb T C 2: 52,278,815 S1903G probably benign Het
Nfe2 T A 15: 103,249,129 D145V probably damaging Het
Olfr243 T A 7: 103,717,480 Y295* probably null Het
Padi1 A T 4: 140,814,853 V586D probably damaging Het
Pcdha11 A T 18: 37,012,386 H510L probably damaging Het
Plcb1 C A 2: 135,260,566 P221H probably benign Het
Plekhg2 A T 7: 28,370,431 V58E probably damaging Het
Pparg A C 6: 115,490,071 Q435P probably damaging Het
Ppp1r36 A G 12: 76,438,118 T282A possibly damaging Het
Prcd T C 11: 116,668,284 probably benign Het
Pygo1 A T 9: 72,944,984 H151L possibly damaging Het
Rnmt A G 18: 68,313,702 Y266C probably benign Het
Rxrb T C 17: 34,036,437 V246A probably damaging Het
Sart1 A G 19: 5,383,676 S378P probably damaging Het
Sema4d T C 13: 51,711,354 N318S possibly damaging Het
Sis C T 3: 72,891,421 V1765I probably benign Het
Slc17a6 A T 7: 51,626,850 K116* probably null Het
Smc6 T A 12: 11,291,539 H519Q probably benign Het
Sowahc T A 10: 59,222,963 M307K probably benign Het
Sptbn1 A G 11: 30,137,560 Y960H probably damaging Het
Tmem270 A C 5: 134,902,782 V102G probably benign Het
Tmprss11d A G 5: 86,338,870 F54L probably benign Het
Top1 T A 2: 160,702,775 Y270* probably null Het
Trpm2 A G 10: 77,935,961 F615L probably benign Het
Ttf2 A G 3: 100,959,242 S525P probably damaging Het
Ttn A T 2: 76,946,897 M1387K possibly damaging Het
Upk3bl A T 5: 136,060,100 R156W probably damaging Het
Usp34 G T 11: 23,349,198 R290L probably benign Het
Vwf T C 6: 125,643,042 V1561A Het
Zan A G 5: 137,421,893 I2834T unknown Het
Zfp105 A G 9: 122,926,389 Y90C probably benign Het
Zfp804a T C 2: 82,258,995 V1056A probably damaging Het
Zfp956 A T 6: 47,953,521 probably benign Het
Other mutations in Pcdh12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Pcdh12 APN 18 38281457 missense probably benign
IGL00964:Pcdh12 APN 18 38282731 missense probably benign 0.27
IGL01105:Pcdh12 APN 18 38275347 missense probably damaging 1.00
IGL02011:Pcdh12 APN 18 38281420 missense probably damaging 1.00
IGL02234:Pcdh12 APN 18 38283535 missense probably damaging 1.00
IGL02452:Pcdh12 APN 18 38281693 missense probably benign 0.00
IGL03412:Pcdh12 APN 18 38283515 missense probably benign 0.24
R0729:Pcdh12 UTSW 18 38282464 missense probably benign 0.20
R1330:Pcdh12 UTSW 18 38281861 missense probably benign 0.13
R1394:Pcdh12 UTSW 18 38281189 critical splice donor site probably null
R1413:Pcdh12 UTSW 18 38283443 missense probably damaging 1.00
R1993:Pcdh12 UTSW 18 38282143 missense possibly damaging 0.62
R2115:Pcdh12 UTSW 18 38283986 missense probably damaging 1.00
R2567:Pcdh12 UTSW 18 38282096 missense probably damaging 1.00
R2926:Pcdh12 UTSW 18 38282390 missense probably damaging 0.99
R3810:Pcdh12 UTSW 18 38281237 missense probably damaging 1.00
R3813:Pcdh12 UTSW 18 38283614 nonsense probably null
R5275:Pcdh12 UTSW 18 38284101 utr 5 prime probably benign
R5400:Pcdh12 UTSW 18 38268898 missense probably damaging 1.00
R5539:Pcdh12 UTSW 18 38281744 missense possibly damaging 0.77
R5604:Pcdh12 UTSW 18 38268882 missense probably damaging 1.00
R6012:Pcdh12 UTSW 18 38283752 missense probably damaging 1.00
R6042:Pcdh12 UTSW 18 38281505 missense probably damaging 1.00
R6129:Pcdh12 UTSW 18 38277859 missense probably damaging 1.00
R6239:Pcdh12 UTSW 18 38282401 missense probably damaging 1.00
R6508:Pcdh12 UTSW 18 38281337 nonsense probably null
R7250:Pcdh12 UTSW 18 38281976 missense probably benign
R7259:Pcdh12 UTSW 18 38281624 missense probably benign 0.00
R7271:Pcdh12 UTSW 18 38283047 missense probably damaging 1.00
R7489:Pcdh12 UTSW 18 38281789 missense possibly damaging 0.77
R8103:Pcdh12 UTSW 18 38282159 missense probably damaging 1.00
R8157:Pcdh12 UTSW 18 38282797 missense probably benign
R8322:Pcdh12 UTSW 18 38281577 nonsense probably null
R8503:Pcdh12 UTSW 18 38282521 missense possibly damaging 0.86
R8510:Pcdh12 UTSW 18 38282056 missense possibly damaging 0.89
Z1177:Pcdh12 UTSW 18 38282992 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GACCGTTGTTTCCTGAGTCC -3'
(R):5'- AGAAGACACTGTTCCTGGTACTC -3'

Sequencing Primer
(F):5'- GAAGCTATCCCTGGGAAGATCTTC -3'
(R):5'- CTTCTCATAAACCTGACTGCTACAG -3'
Posted On2016-10-05