Incidental Mutation 'R5529:Ky'
ID433586
Institutional Source Beutler Lab
Gene Symbol Ky
Ensembl Gene ENSMUSG00000035606
Gene Namekyphoscoliosis peptidase
SynonymsD9Mgc44e
MMRRC Submission 043087-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.316) question?
Stock #R5529 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location102505750-102546239 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 102542075 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 427 (S427L)
Ref Sequence ENSEMBL: ENSMUSP00000036032 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039390]
Predicted Effect probably benign
Transcript: ENSMUST00000039390
AA Change: S427L

PolyPhen 2 Score 0.097 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000036032
Gene: ENSMUSG00000035606
AA Change: S427L

DomainStartEndE-ValueType
TGc 217 285 1.9e-14 SMART
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 95.7%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes for a spontaneous mutation exhibit severe degenerative myopathy involving postural muscles, resulting in thoraco-lumbar kyphoscoliosis with degenerative changes in intervertebral discs. Body weight is reduced and breathing is irregular. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,264,881 Y2079C probably damaging Het
Alg2 T C 4: 47,472,101 R236G probably damaging Het
Alpl T A 4: 137,746,422 N323I probably damaging Het
Anxa3 A G 5: 96,828,379 E172G probably benign Het
Atp8a2 A G 14: 59,793,865 probably null Het
Cadps T C 14: 12,454,285 K1078E probably damaging Het
Ces2e G T 8: 104,929,911 V258L probably benign Het
Daam2 A G 17: 49,459,057 F1041S probably benign Het
Dcstamp A G 15: 39,754,536 I114V probably benign Het
Ddhd2 C T 8: 25,739,560 R496Q probably benign Het
Dnhd1 G A 7: 105,703,209 R2523Q probably damaging Het
Eml6 T A 11: 29,764,126 R1335S probably benign Het
F12 T C 13: 55,422,059 N102S probably benign Het
Fbn1 G A 2: 125,373,950 L712F probably benign Het
Fgf1 G T 18: 38,858,604 F37L probably damaging Het
Fgf14 T A 14: 123,980,455 H212L probably damaging Het
Gm10036 A T 18: 15,832,801 Q3L probably benign Het
Hivep1 T C 13: 42,156,650 F789L possibly damaging Het
Hspg2 C A 4: 137,551,828 T3074N probably damaging Het
Katnb1 C T 8: 95,097,672 R495C probably damaging Het
Kdm5b C T 1: 134,588,003 H122Y probably damaging Het
Med9 T G 11: 59,960,660 V105G probably benign Het
Ndufa11 T A 17: 56,721,059 V43D probably damaging Het
Nlrp4b T A 7: 10,714,946 C359S possibly damaging Het
Olfr361 T A 2: 37,084,909 I280F possibly damaging Het
Olfr558 A T 7: 102,709,693 K145* probably null Het
Paxbp1 T A 16: 91,030,513 Y478F possibly damaging Het
Pole G A 5: 110,332,466 E92K probably benign Het
Prom1 G T 5: 44,026,768 L449M probably damaging Het
Psg28 G A 7: 18,430,448 T113I probably benign Het
Reln A C 5: 21,932,715 V2493G possibly damaging Het
Rp1 C T 1: 4,345,832 V1686I probably benign Het
Setbp1 T C 18: 79,086,652 I122V probably damaging Het
Setd5 T C 6: 113,121,568 Y721H probably damaging Het
Shroom1 T C 11: 53,463,922 F223S probably damaging Het
Son T A 16: 91,655,466 L367Q probably damaging Het
Spred2 G T 11: 20,021,301 D363Y probably damaging Het
Tbc1d8 T G 1: 39,372,755 Y1000S probably benign Het
Tdp2 A T 13: 24,838,236 K213* probably null Het
Tmem89 T C 9: 108,915,477 I146T probably damaging Het
Vhl T C 6: 113,629,463 V147A probably benign Het
Vmn2r23 C T 6: 123,713,451 L429F probably benign Het
Vrk2 T C 11: 26,499,036 D186G probably damaging Het
Wisp2 T C 2: 163,825,359 probably null Het
Zbtb40 A G 4: 136,983,163 F1222L possibly damaging Het
Zfp266 A G 9: 20,506,734 S7P probably damaging Het
Zfp472 T A 17: 32,978,433 I494K possibly damaging Het
Zfp655 A G 5: 145,244,736 E468G probably damaging Het
Other mutations in Ky
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01515:Ky APN 9 102542105 missense probably benign
IGL02197:Ky APN 9 102537786 missense possibly damaging 0.63
PIT4802001:Ky UTSW 9 102537773 missense probably benign 0.00
R0384:Ky UTSW 9 102542090 missense probably benign 0.05
R0620:Ky UTSW 9 102537621 missense probably benign 0.04
R1099:Ky UTSW 9 102537724 missense probably damaging 1.00
R1754:Ky UTSW 9 102541927 missense possibly damaging 0.54
R2075:Ky UTSW 9 102542746 missense probably damaging 0.98
R2322:Ky UTSW 9 102537791 critical splice donor site probably null
R2415:Ky UTSW 9 102541891 missense probably damaging 1.00
R3950:Ky UTSW 9 102542428 nonsense probably null
R4419:Ky UTSW 9 102542710 missense probably damaging 1.00
R4786:Ky UTSW 9 102541987 missense probably benign 0.02
R5261:Ky UTSW 9 102537599 critical splice acceptor site probably null
R6857:Ky UTSW 9 102542432 missense probably damaging 1.00
R6931:Ky UTSW 9 102537627 missense probably damaging 1.00
R7205:Ky UTSW 9 102542292 missense probably damaging 1.00
R7211:Ky UTSW 9 102509150 missense probably benign 0.08
R7570:Ky UTSW 9 102542329 missense probably benign 0.00
R7642:Ky UTSW 9 102542270 missense probably benign 0.32
R7644:Ky UTSW 9 102537773 missense probably benign 0.00
R7910:Ky UTSW 9 102541942 missense possibly damaging 0.54
R7991:Ky UTSW 9 102541942 missense possibly damaging 0.54
Predicted Primers PCR Primer
(F):5'- GCAGTCAATGGGAAAGCCAC -3'
(R):5'- TCATCGCCATGAAGGGATG -3'

Sequencing Primer
(F):5'- CAATCACCATCGAGAGCCGG -3'
(R):5'- TTCCACGCTAAAGCTGATGG -3'
Posted On2016-10-06